Skip to main content

Table 1 Primers of candidate PCR reference genes

From: Identification and evaluation of PCR reference genes for host and pathogen in sugarcane-Sporisorium scitamineum interaction system

Category Gene Name Sense Primer/Anti-sense Primer (5′-3′)
Sugarcane Acyl-CoA dehydrogenase family member 10, ACAD CGTGGCATGGATCTGATGGT/AGCCTGCTCCAGTTCAATCC
Sugarcane Casein kinase I isoform delta-like, CK1δ TCAAGGGCTACCTCCCTCTC/GCATTCTTCCCTTCCGCTCT
Sugarcane OTU domain-containing protein 5, OTU5 TGGTGCAGAGCCCATTAACA/GCCTTCACCTGGTCCCTATC
Sugarcane 12-oxophytodienoate reductase 7, OPR7 TGTTCATCGCTAACCCGGAC/TTAGGCTGGCCAAGGAATGG
Sugarcane Polyadenylate-binding protein 8, PABp8 TTGGGACTCTGACTTCTGCC/CCAGTGACCTTTGCTGCTTG
Sugarcane Serine/arginine repetitive matrix protein 1, SARMp1 TGGACTTGGTCAGTTGGAAACA/TGTTCCTGAAGCCTATGTTGCT
Sugarcane Glyceraldehyde-3-phosphate dehydrogenase, GAPDH AGGACTCCAAGACCCTCCTC/CTTCTTGGCACCACCCTTCA
Sugarcane Eukaryotic elongation factor 1A, eEF1Aa TTTCACACTTGGAGTGAAGCAGAT/GACTTCCTTCACAATCTCATCATAA
Sugarcane Cullin, CULa TGCTGAATGTGTTGAGCAGC/TTGTCGCGCTCCAAGTAGTC
Sugarcane Clathrin adaptor complex, CACa ACAACGTCAGGCAAAGCAAA/AGATCAACTCCACCTCTGCG
Sporisorium scitamineum Conserved hypothetical protein, S2 ACCTCGAGCAGCAACAGTG/ACCACAATCCAGAACTCGACG
Sporisorium scitamineum Conserved hypothetical protein, S4 GACGGTGCCCAAGAACAGAG/CTGTGAGCTTCCAATTCCGC
Sporisorium scitamineum VPS73-protein involved in vacuolar protein sorting, S6 AAAACCTAATGGTGGGCTCGG/GACCCAACCCGAACGAGAAC
Sporisorium scitamineum Synaptobrevin, S8 TGCACAAGACCATCGACTCA/CGAGTTTTGCTTCTTGGCTGT
Sporisorium scitamineum GTP binding protein Rac1, S9 CACGTGATATCCATGCGAACAAG/GAGAATGGTGCAGTTGTTCTTCT
Sporisorium scitamineum Inosine 5`-monophosphate dehydrogenase, S10 CGTTGCAGGACATGGGTGTG/TTCTCGTAGCTGTGCAGACCA
Sporisorium scitamineum SEC65-signal recognition particle subunit, S11 GAATGCTTGGAGGCATGGGG/GCGGGTTCATAGGGTCCTTC
Sporisorium scitamineum ADP-ribosylation factor, S12 AACGACCGAGAGCGTGTTTC/AGCTTGTCCGTAATCTCGGC
  1. Note: aLing et al., 2014