Skip to main content

Table 1 Primers for RT-qPCR amplification of miRNAs

From: Identification and characterization of miRNAs in the gills of the mud crab (Scylla paramamosain) in response to a sudden drop in salinity

ID Primer Sequence (5′-3′)
miR-7 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAACAAA
Forward GTGGAAGACTAGTGATTTTG
Reverse TGCGTGTCGTGGAGTC
novel_mir16 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCTGAAC
Forward GCACCGAAGCTTAGGGTT
Reverse TGCGTGTCGTGGAGTC
novel_mir18 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGAATAC
Forward GCCTATAATGGCTATTGGTA
Reverse TGCGTGTCGTGGAGTC
novel_mir19 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGCATCT
Forward ATCCTTGGACCACAGCAG
Reverse TGCGTGTCGTGGAGTC
novel_mir22 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACACCT
Forward TGAGGGTGACTGGCAGG
Reverse TGCGTGTCGTGGAGTC
novel_mir24 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTTCGGC
Forward CACCACTCTTGTCTCTGC
Reverse TGCGTGTCGTGGAGTC
novel_mir26 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCGAGT
Forward ATGATGGCAGCGGTGACT
Reverse TGCGTGTCGTGGAGTC
novel_mir31 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACTGAC
Forward CTAATTTGAGCCATCTGTCA
Reverse TGCGTGTCGTGGAGTC
novel_mir34 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAAGATG
Forward CACAGCCGTGTAGTCATC
Reverse TGCGTGTCGTGGAGTC
novel_mir35 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTGGCCA
Forward GTATTGGGCGTGTGTTGG
Reverse TGCGTGTCGTGGAGTC
.novel_mir37 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTGAGGA
Forward TCGCAGATCCAGAATGTTC
Reverse TGCGTGTCGTGGAGTC
novel_mir40 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACTGAAG
Forward TGGAATGCATGGCTACACT
Reverse TGCGTGTCGTGGAGTC
novel_mir45 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTGTCCG
Forward GGCGTGGCAGGGGTTTC
Reverse TGCGTGTCGTGGAGTC
novel_mir47 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCGAGT
Forward ATGATGGCAGCGGTGACT
Reverse TGCGTGTCGTGGAGTC
novel_mir48 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACAGGC
Forward TACCCTGATATTCCTTGCC
Reverse TGCGTGTCGTGGAGTC
novel_mir5 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTTTGGGA
Forward TCAATGCCCTTGGAAATCC
Reverse TGCGTGTCGTGGAGTC
novel_mir53 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTTAGG
Forward GGGTTAGTCGGGTCCTA
Reverse TGCGTGTCGTGGAGTC
novel_mir7 RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCTCACA
Forward GATGACTACACGGCTGTG
Reverse TGCGTGTCGTGGAGTC
18S rRNA Forward GGAATTCCCAGTAAGCGCAA
Reverse CCAGTCCGAAGGCCTCACTA
  1. 18S rRNA: a reference gene of the S. paramamosain