Skip to main content

Table 4 Primer sequences used to detect plasmids in L. lactis FM03P

From: Large plasmidome of dairy Lactococcus lactis subsp. lactis biovar diacetylactis FM03P encodes technological functions and appears highly unstable

Target Sequence (5′-- > 3′) Amplicon Tm (°C)
Chromosome Fw TTAATTCAACCTGGAGACACAGTCTTAG 254 65.2
Rv CTATCAGCGATTTCACGGAACTTAG 65.6
pLd1 Fw GCATTGACGGCTGTTGTAAT 209 62.5
Rv AGCAGATTCCCGAGGATAAC 62.0
pLd2 Fw AATGGGCCGAAGGTTCTATT 285 63.4
Rv CAGGAACCGATTCTCCTGTTA 62.9
pLd3 Fw CCTCTCGCGTTCCTTGATA 417 62.9
Rv CCACGTAAGGGCGATTTAGT 62.7
pLd4 Fw GCGGTAACAACATCCGTATC 508 61.8
Rv AGTCAGCCCAAGCGACTAAT 62.7
pLd5 Fw AAATACAAGTGTTGAAGGCGTTG 589 63.8
Rv ACCTTTGTTCTCCAATTTCAGC 62.2
pLd6 Fw TAAGTGCAACTAAAAGAAATAATAAAGTGCAA 200 65.1
Rv TTGCTGATGATTGTACCAGCTAAAAC 65.8
pLd7 Fw TGGGCATCTAGATAATCTGACGACATCTGT 596 71.3
Rv CGACATTGACTCCCCAAAAACCAAAAATGA 75.3
pLd8 Fw CCCAGTTGATTTAGAATTAGCTGAAGAATA 588 65.8
Rv AGATAGGTTGCATCCAAGATAAATTTGTTA 65.9
pLd9 Fw TAGTCGCTGGCAAATTTTACAATCA 323 67.0
Rv CTTTGGGGGTTGCTTTAGAATCAAT 67.5
pLd10 Fw ACGCTTGAACCCCATCTTGG 255 68.3
  Rv TCGTCCCAAACGGTTTACCC 67.8
pLd11 Fw TTCAATGAATGGCTCGGAAGAA 388 67.6
  Rv TTTCGGCACAGGAGCAACAT 67.9
pLd12 Fw GAAAACTAATCTAGTACAATCATCAGCAAACTT 277 65.1
  Rv TTTTTACGAGTTATATTGTTTCTAGTCAGATTCTT 64.7
  1. Primers were used to determine the plasmid content of different variants and to discriminate variants in competition experiments