Skip to main content

Table 1 qRT-PCR primer sequences

From: Changing expression profiles of long non-coding RNAs, mRNAs and circular RNAs in ethylene glycol-induced kidney calculi rats

  Forward primer Reverse primer
TCONS_00030209 AGTCAAATTCATGGGACTCG GTGTGGTCAGGTCAATCTCTA
NONRATT009934.2 CAGATGACACCGTTAGGAT TCAGGAAAGAAGGAAGCAACC
TCONS_00026280 CTGTGTGATTGAGGCAATCT GTACTGGCTGGATTTCGTC
ENSRNOT00000000139 TTTGGTGTAGAGGATGACGAC GGCTGCTGGAAGATGAAC
ENSRNOT00000006106 ACTGGACGTTCCATGAAAG GCCAGCTCACAGGAAGTA
ENSRNOT00000003823 CTGTCCACAATGAGCTTCC CAGCAGGGTGAATGACGA