Skip to main content

Table 4 TaqMan assays and PCR efficiencies of selected genes outlined in Table 3 across 6 salmonid species

From: Developing specific molecular biomarkers for thermal stress in salmonids

Symbol Chromosome Primers and TaqMan Probes PCR Efficiency
O. tshawytscha
(Chinook)
O. kisutch
(Coho)
O. keta
(Chum)
O. gorbuscha
(Pink)
O. nerka
(Sockeye)
S. salar
(Atlantic)
SERPINH1 20 F-ACTATGACCACTCGAAGATCAACCT
R-CCCATTCGTTGATGGAGTTCA
P-AGGGACAAGAGGAGC
0.75 0.90 0.87 0.79 0.89 0.84
SERPINH1 9 F- GAGGTCAGCGACCCAAAGAC
R- GCCGTAGAGGCGGTTACTGAT
P- CGGAACGTCACATGGA
0.84 0.97 0.96 0.95 0.92 1.08
HSP90AA1 6 F- TTGGATGACCCTCAGACACACT
R- CGTCAATACCCAGGCCTAGCT
P- CCGAATCTACCGGATGAT
0.91 0.88 0.98 0.98 0.87 0.87
HSP90AB1 15 F- GACACGGTGTTGGGTTGGTT
R- TTGCAGTCAACTCTCCATGCA
P- TCATGTGCAACATAACAT
0.86 0.85 0.78 0.88 0.83 0.77
HSP90AA1 15 F- ATGACCCTCAGACACACTCCAA
R- CCTCATCAATACCCAGTCCTAGCT
P- CGCATCTACAGAATGA
0.82 0.70 0.68 1.00 0.85 0.84
HSC71 9 F- CTTAGGGACGCCAAGATGGA
R- GAGCCTCCCACCAGGACAA
P- AAGCCCAGGTCCACGAC
0.90 0.86 1.33 0.94 0.86 0.82
HSP70 6 F- TCAACGATCAGGTCGTGCAA
R- CGTCGCTGACCACCTTGAA
P- CCGACATGAAGCACTGG
0.88 1.02 0.81 0.89 0.82 0.65
PDIA4 19 F- TGAGGTGCAGGACTTTTTTAAGAA
R- TCGTTGCTCTGTTTCCTGTGA
P- ACATCCTGCCACTGGT
0.90 0.88 0.81 0.90 0.86 0.93
SEPW1 11 F- TGAGGATGAATTCCCAGGTGAT
R- AAACCACCCAGAGGTTGAAGGT
P- TTGAGATTACTGGTGAAAGC
0.84 0.83 0.73 0.91 0.84 0.87
MAP3K14 3 F- GCTCCCTGGGTTCATGGAT
R- GCCTCCCTTCAGCAGAGACA
P- CCAGCAATAGCTTATG
0.93 0.78 0.78 1.09 0.85 1.03
PARK7 22 F- ACTGCAAGCAGCATGATCAACT
R- TTGGCCTGTGTATCATAATGAACA
P- CCCCACCTACTCAGC
0.94 0.85 0.81 0.97 0.91
COX6B1 19 F- GCCCCGTGTGACTGGTATAAG
R- TCGTCCCATTTCTGGATCCA
P- TCTACAAATCACTGTGCCC
1.05 0.90 0.86 0.91 0.85 0.75
EIF4A2 14 F- CAGAAACTGAGCACAAACATTCAA
R- GGACATCTGCAGGCATGGTA
P- TGGTCCTCCTCTCTG
0.90 0.99 0.87 0.86 0.89 0.73
EIF4ENIF1 12 F- AGCTCCATCCCAGCCTTGT
R- AAATATGCCTGCCTGCATCAG
P- CCAGGGCATCCAGCCA
0.75 0.86 0.74 0.71 1.16
TUBA1A 16 F- CTCTGCTGAGAAGGCCTACCAT
R- AGCAGGCGTTGGTGATGTC
P- AGCAGCTGTCTGTTGC
0.90 0.86 0.79 0.93 0.86 0.86
TUBA1A 11 F- AGACCGGAGCGGGAAAAC
R- ACAACAGTTGGTTCGAGATCCA
P- TGTCCCCCGTGCTGT
1.10 0.87 0.83 0.86 0.87 1.48
NEK4 12 F- TGCGGCAGCTAAAATTCTTTG
R-AATGCATTTTTCATTAGCTGATCCT
P-AGACGTTTCTTTCAAGGGT
0.78 0.92 0.67 0.84 0.85 1.17
UBE2Q2 26 F- GGCAGGACCACTTGAACGTAA
R- AGGCCTGCACTGAACCAGAT
P- TGCTCATTCGGGTGCG
0.92 1.13 0.80 1.08 0.87 0.75
FKBP10 3& 6 F- ACTATGAGAATGCCCCCATCAC
R- CTCGTCCAGACCCTCAATCAC
P- CCTGGGAGCCAACAA
0.89 0.88 0.86 1.05 0.85 0.66
FKBP10 19 F- CCTGAAGAGATCATTGCTGACATG
R- GACGATGACCCCATCCTTGT
P- TCAGGAACCAGGACCG
0.97 0.82 0.84 0.76 0.89 0.80
CIRBP 16 F- GGGATGGTGGAGACCTTCTCT
R- CAGAACCCACAGCGATCCTAA
P- TTCTCTAGTCCACTGGGCT
2.13 0.89 1.83 1.56
CIRBP 10 F- TGATTGACTGTTTTGCCAACTGA
R- TCAGACCTTTGTGTGCATTTACCT
P- ATGGTGATGAGCCTGAAT
1.06 0.81 0.83 0.87 0.84 0.85
SFRS9 1 F- ACATTCGTGTCCACGGAGAAC
R- GGACCCTCTGCTTTTGTAAGGA
P- TGCCAGTTATGGTCGCT
0.85 0.98 0.95 1.27 1.04 0.91
SFRS2 3 F- TCCAGATGGCCCGTTACG
R- CACCACCGCCTCCATGAT
P- TCCCCCAGATTCT
0.87 0.85 0.82 0.90 0.85 0.81
EEF2 14 F- AGGTCACAGCCGCCCTTAG
R- ACACAGTCTCTGTCTGCACACACA
P- CGACTGCGTCTCAGGT
0.88 0.87 0.82 0.89 0.84 0.89
SCFD1 1 F- GACAAGAAGCTGAGGGAGAACCT
R- GCCGGCCCCCATATTG
P- ACAGCCTGTTCACTGGA
0.84 0.88 0.89 0.99 0.88 0.73
MPDU1 7 F- TGCTTGACCCCTTGATTATAGCTA
R- GACCATAATCTAGAATGAAAACGCATT
P- CTTCCTGGTTGTGTTCTG
0.93 0.78 0.78 1.09 0.85 1.03
IDH3B 12 F- AGAAATCTCTACCACAGCACTGTATCA
R- GGCACGACTCAGGACTGTGA
P- TGGATATCTGGCCTGTCAT
0.85 0.85 0.83 0.88 0.85 0.78
zgc:63572 11 F- GGCTATCCCTGGTGACTCTGAT
R- ACCAGTGGTTGCCTCCTTTCT
P- CCACGACCTTCGGC
0.92 0.87 0.72 0.94 0.87 0.87
KCT2 13 F- TGTTCTCACCATGTTTAAGCCTTACT
R- TGCAATCAGCACAAACACTTAAGA
P- CTTCTACACTTATTGTTTTGC
0.85 0.90 0.83 0.86
AP3S1 24 F- TGGCATGTTGTTAGCCTGCTA
R -TCTACCTGGGAACCGACTCTAATC
P- CCGTAATTTGAGCTAGATTG
0.88 0.88 1.00 1.22 1.03 1.00
ZMYND11 3 F- TCGCCCCACTGTCACTCA
R- GATTCGGTCCACAAAGTGTTCA
P- ACACCCCTACCTGCCTT
0.87 0.82 0.75 1.09 0.79 0.68