Skip to main content

Table 3 Seven most abundant novel miRNAs identified in black, white, and red Koi carp skin samples

From: Identification and characterization of skin color microRNAs in Koi carp (Cyprinus carpio L.) by Illumina sequencing

miRNA Sequence BS Count RS Count WS Count
novel-miRn0378 CAAGCTTGTTTCTATGGGTCTC 1720 1693 1940
novel-miRn0924 TAGATCAGTGAACTTGCCTTTA 2056 1388 1664
novel-miRn1323 TCAGTCACCGTTCACTTACATT 1414 1129 1356
novel-miRn0321 TGGAAACATTCTACACTCTCAGA 1242 931 1163
novel-miRn0902 CAAGCTCGATTCTGTGGGTCT 1027 746 792
novel-miRn0547 AATGCAAGAACACATCCTGAGT 832 662 805
novel-miRn1422 ATTATGAACATGATATTGAAT 415 370 424