Skip to main content

Table 4 Ten most abundant novel miRNAs differentially expressed in black, white, and red skin samples

From: Identification and characterization of skin color microRNAs in Koi carp (Cyprinus carpio L.) by Illumina sequencing

miRNA Sequence BS Count RS Count WS Count
novel-miRn0022 TAAAATGGACCATTGACACTCT 750 531 1165
novel-miRn0032 TCTGCAACACGAAACTGTCTTA 522 47 1108
novel-miRn0678 AAGTTCTGTGGTCCACTCTGGCT 1328 337 569
novel-miRn1387 ACTGATTTCCTCTGGTGCTTGGA 1099 779 577
novel-miRn1534 TCACGCTGCGGATCAGATGCTC 804 629 501
novel-miRn0032 TAAAGAGAACCGCCGCAAACGC 307 53 170
novel-miRn0824 AACGATCTTTAAACATTAATCT 266 77 510
novel-miRn0849 TTCAAACGGACCATTGACATTC 97 131 238
novel-miRn1070 GATCGTGATGAAACTTTAACC 376 138 581
novel-miRn1199 TTCAGTGAAGATAATCTGTCC 139 55 84