Skip to main content

Table 1 Known miRNAs in cucumber shoot tips

From: MicroRNAs and their targets in cucumber shoot apices in response to temperature and photoperiod

miRNA Family membera Dominant sequence (5p) count(5p) Dominant sequence (3p) count(3p) Previously identified
csa-miR156 7 TGACAGAAGAGAGTGAGCAC 407,153 TGCTCACTTCTCTTTCTGTCAGC 128 M Y X
csa-miR157 4 TTGACAGAAGATAGAGAGCAC 2,059,132 GCTCTCTATGCTTCTGTCATC 158   Y X
csa-miR159 1 ATTGGATTGAAGGGAGCTCC 14 M Y X
csa-miR160 3 TGCCTGGCTCCCTGTATGCCA 11,461 GCGTATGAGGAGCCAAGCATA 24,040 M Y X
csa-miR162 1 GGAGGCAGCGGTTCATCGACC 318 TCGATAAACCTCTGCATCCAG 3306   Y X
csa-miR164 5 TGGAGAAGCAGGGCACGTGCA 253,447 CACGTGCTCCCTTTCTCCAAC 1649 M Y X
csa-miR166 8 GGAATGTTGTCTGGCTCGAGG 92,459 TCGGACCAGGCTTCATTCCCC 3,561,572 M Y X
csa-miR167 6 TGAAGCTGCCAGCATGATCTA 2,016,681 GATCATATGGTAGCTTCACC 34 M Y X
csa-miR168 2 TCGCTTGGTGCAGGTCGGGAA 172,731 TCCCGCCTTGCATCAACTGAA 17,238 M Y X
csa-miR169 12 AAGCCAAGGATGAATTGCCGG 35,494 GGCAATTCCATTCTTGGCTAAG 511 M Y X
csa-miR171 7 TATTGGTCCGGTTCACTCAGA 1589 TGATTGAGCCGCGCCAATATC 4086 M Y X
csa-miR172 5 GCGGCATCATCAAGATTCACA 3255 AGAATCTTGATGATGCTGCAT 132,778 M Y X
csa-miR390 4 AAGCTCAGGAGGGATAGCGCC 174,310 CGCTATCCATCCTGAGTTTCA 1220 M Y X
csa-miR393 3 TCCAAAGGGATCGCATTGATC 146 ATCGTGCGATCCCTTAGGAAT 11 M Y X
csa-miR394 2 TTGGCATTCTGTCCACCTCC 1749 AGGTGGGCATACTGCCAATTG 11   Y X
csa-miR395 4 GTTCCCTTCCAAACACTTCAGA 1 TGAAGTGTTTGGGGGAACTC 33    X
csa-miR396 5 TTCCACAGCTTTCTTGAACTT 223 GCTCAAGATAGCTGTGGGAAA 1433 M Y X
csa-miR397 1 TCATTGAGTGCAGCGTTGATG 188 M Y X
csa-miR398 1 GAGTGAACCTGAGAACACAAGA 15,821 TTGTGTTCTCAGGTCACCCCT 105 M Y X
csa-miR399 6 GGGCGGATCTTTTTTGGCAGG 239 TGCCAAAAGAGACTTGCCCTG 6739 M Y X
csa-miR408 1 GCGGGGAACAGACAGAGCATG 2242 ATGCACTGCCTCTTCCCTGGC 352 M Y X
csa-miR477 2 TTCTCTCCCTCAAGGGCTTCGA 324 GAAGCCCACGAGGAGGGGATG 228   Y  
csa-miR530 2 TGCATTTGCACCTACACCTTC 3949   Y X
csa-miR827 1 TTAGATGACCATCAACGAACG 90 M Y X
csa-miR860 1 TCAAAGATTGGACAAAATTAT 12    
csa-miR1038 1 CAATGGTGGAATCGATCAGGC 7    
csa-miR1041 5 TTTGTACGGGTGAGAGTGGTCAG 28    
csa-miR1044 3 TTGAATAATGCATATTTTTTT 7    
csa-miR1120 1 TAAGTATAAGATCGTTTAGAC 14    
csa-miR1886 1 TGAAGAAGTAGATGAAGAGTC 170    
csa-miR1888 1 TTATTAAGATTGTTTGAAGAA 7    
csa-miR2111 2 TAATCTGCATCCTGAGGTTTA 14,800 GTCCTTGGGATGCAGATTATC 39   Y X
csa-miR2628 1 CTGAAAGAGAAGATGAATAA 14    
csa-miR2950 1 TTCCATCTCTTGCACACTGGA 6356 TGGTGTGCATGAGATGGAATA 14,275 M Y X
csa-miR3512 1 TCACAAATGAAGACAATAGA 32    
csa-miR3704 1 GGTGTACGGTGGAGTGGAAAATA 26    
csa-miR4234 1 CAAATTAAAATCGTGGGCAT 8    
csa-miR4249 3 TGAATTTGGAGAAGGAGAGTA 18    
csa-miR4383 1 TATTGGAGCATCAGTGAAACGTC 234    
csa-miR4414 1 AGCTGCTGACTCGTTGGCTCA 716,542 AACCAACGATGCAGGAGCCAA 123    X
csa-miR5041 1 CTTAGAGCAGATGAAGATGAA 20    
csa-miR5083 1 AGACTACAATTATCTGATCA 1274    
csa-miR5225 1 CCGCAGGAGAGATGACACCCAC 14    
csa-miR5242 1 TTGTAGAAATCAAAGATGACA 7    
csa-miR5337 1 TTAGGAACGGTAGCAATTTGA 16    
csa-miR5532 1 TGGAATATATGACAAAGGTGG 59    
csa-miR5667 1 AAAAGAGATCAAATGGATGCC 13    
csa-miR5671 1 TATGGTAGTAGACATCGGGTGAC 11    
csa-miR5747 1 TTAGAATACTCATACATACATTA 8    
csa-miR5751 1 TTGATGTTGATCAATGGATATTT 174    
csa-miR5760 1 TGCTTTAGGATTTGTTTAGGAT 6    
csa-miR5788 2 TGGATGTGAAGACAGCTAGTA 53    
csa-miR6182 1 TGTAGTTGATGGATGGATGCTTT 12    
csa-miR6257 1 TCTTAACTAGTTGAATTATGT 9    
csa-miR6300 1 GTCGTTGTAGTATAGTGGTA 9345    
csa-miR6421 1 TACGATGAGATTGTAAGGGAG 8    
csa-miR6426 5 GTAGAGACATGGAAGTGGAGACA 252    
csa-miR6440 1 GAGTTGATCGAATTTCGTAGTTT 14    
csa-miR7129 13 TCAAATCTAAACGATCGTTTTTC 137    
csa-miR7499 1 TATATTTTCGGGTTATTTGGGTT 8    
csa-miR7741 1 TGTTATTGTGGAAGTTCTTGA 1286    
csa-miR8125 1 CAGGAGAAGAATGTGAAAAGGTA 64    
csa-miR8608 1 TTTCTACACGATCGTTTGACATG 6    
csa-miR8657 1 TCGTAGAAATTGTAGAAGCAGGC 15    
csa-miR8693 2 AGATGAAAGAGATAGATGAGCAT 30    
csa-miR9408 1 CAACAATCGTCAGGATAGAAAAT 56    
csa-miR9759 1 TATGAACCAAGGTAGAATTTAAA 37    
csa-miR9776 1 TTCGGACGAGGATGTTAACGG 12    
Total 164   5,992,813   3,781,493    
  1. aDetailed information including nomenclatures, genome location, mfe, sequences and counts of 5p and 3p mature miRNA, precursor sequences and their secondary structures are listed in Additional file 1: Table S2. M: previously identified in ref [44]; Y: previously identified in ref [43]; X: previously identified in ref [42]