Skip to main content

Table 2 Design primers for Real-Time PCR

From: Differential gene expression for carotenoid biosynthesis in a green alga Ulva prolifera based on transcriptome analysis

Gene name →Forward primer (5′ 3′) →Reverse primer (5′ 3′)
18S rDNA CGCAACTCCCGACTCACGAAGG ATCTTTGAGACAAGCATATGACTAC
DXS GCCTGTGCGGTTTGCGATGGAT ACTTCCAGCAACACGGCATCGG
DXR CGGGGAAGATGTTGATGCGCTGAA AAAACACGGCGTCCACATCCTTCC
CMS GGTTCTACTCGCTGGTGGCGTTGG CTTGGCGCTCCGCTCCTGGTAA
CMK TACAGCGTTGCCAAGCGTACCAAA CATGGAAAAGCGACGCCAAATCA
MCS CTTGTTGTTCGGTGATGTGGCTCG CCGGTTTGGCTTGTTTGAAGGTCC
HDS CTGGGAACTTTGCAGACGGAACGA AAGACAGAATGCGGGCACTCAAGC
HDR TTGCGTGGGAGGGGCGTGTTAC AGGTCAGGTTGGTGGCAACATGGG