Skip to main content

Advertisement

Table 4 Primers used for the amplification of Glyoxalase I, II and III from wild type and commercial sugarcane hybrid

From: Comparative analysis of glyoxalase pathway genes in Erianthus arundinaceus and commercial sugarcane hybrid under salinity and drought conditions

Forward Primer (Gly I) ATGGCTGGTGCATCGCTCCTCTCC
Reverse Primer (Gly I) TCATGATGCTGAAGAAGTTACCGTCCCAATC
Forward Primer (Gly II) ATGAGGATGCTGTCGAAGGCGTGCT
Reverse Primer (Gly II) TCAGAAGTTATCTTTTGCTCGACGGACAA
Forward Primer (Gly III) ATGGCGGCGAAGAAGGTGCTCATGCTCT
Reverse Primer (Gly III) TCAGAAGGAAACCTTGACGCCGAGCAA