Skip to main content

Advertisement

Table 6 Real-Time PCR Primers used for the expression analysis of Glyoxalase I, II and III designed using IDT software

From: Comparative analysis of glyoxalase pathway genes in Erianthus arundinaceus and commercial sugarcane hybrid under salinity and drought conditions

Forward Primer (Gly I RT) TTCTTGGTTACGAGGATGTGAC
Reverse Primer (Gly I RT) TTGAAGTCAGGGTCCTTTTCC
Forward Primer (Gly II RT) TTGGAAGGGAGAAGGAATGC
Reverse Primer (Gly II RT) TCAAGCACCCGATCTTCATC
Forward Primer (Gly III RT) GTCCCATTCCAGTCTCTTCAA
Reverse Primer (Gly III RT) CCAGGCTTCTCACTGTAAGTC
Forward Primer (GAPDH RT) AAGGGTGGTGCCAAGAAGG
Reverse Primer (GAPDH RT) CAAGGGGAGCAAGGCAGTT