Skip to main content

Table 2 Terminal inverted repeats (TIRs) and target-site duplication (TSDs) of PePIF1 and other PIF/Harbinger-like transposable elements

From: PePIF1, a P-lineage of PIF-like transposable element identified in protocorm-like bodies of Phalaenopsis orchids

Element Full length (bp) TIR length (bp) TIR sequence TSD Length of ORF1 (a.a.) Length of TPase (a.a.) Reference Accession no.
PePIF1 5053 19 GGGYCYGTTTGGGGCAGCT TTA 272 427 This study  
DcMaster-a 4432 22 GKGYCTGTTTGGSRTTGCKGTT 3 bp 353 425 Grzebelus et al., 2006 AC144478
AtPIF2 4229 20 GGKGGTGTTATTGGTTAGTG TTA 303 399 Zhang et al., 2001 AF007271
OsPIF1 7365 15 GGCCTYGTTTGGCTG TTA -a 398 Zhang et al., 2001 AC025098
OsPIF2 4777 14 GGGGTTGTTTGGTT ATA 303 411 Zhang et al., 2001 AP001111
ZmPIFa 3728 14 GGGCCCGTTTGTTT TTA -a 298 Zhang et al., 2001 AF412282
Harbinger 1530 25 GGTCCTGTTTGTTTGTCCATTTGGA 3 bp -a -a Kapitonov and Jurka, 1999 JX556412
  1. a: ORF1 not found