Table 1 Example of the output table showing the expression values and sequence conservation of the mature microRNAs predicted in Dendrobium officinale
From: PmiRDiscVali: an integrated pipeline for plant microRNA discovery and validation
Mature ID | Mature sequence | Conservation | Mature expression (RPM) | |||
|---|---|---|---|---|---|---|
Flower | Leaf | Root | Stem | |||
Leaf_tc_dof-miR8-5p | AAGCGAAUCCGGACGUGUCACGUC | – | 0.73 | 3.27 | 1.86 | 1.15 |
Leaf_tc_dof-miR8-3p | UGUGGCGCGUCCGGAUUCGCCUCC | 0.00 | 0.13 | 0.00 | 0.00 | |
Leaf_tc_dof-miR36-5p | UCGCUUGGUGCAGGUCGGGAC | Identical to miR168 | 222.74 | 107.83 | 70.50 | 132.34 |
Leaf_tc_dof-miR36-3p | CCUGCCUUGCAUCAACUGAAU | 412.69 | 255.38 | 241.41 | 469.93 | |
Leaf_tc_dof-miR1-5p | UGGAAGGGGCAUGCAGAGGAGC | Similar but not identical to miR528 | 183.19 | 2066.05 | 2511.72 | 3565.33 |
Leaf_tc_dof-miR1-3p | UCCUAUGUAUGCCUCCUCCACU | 9.64 | 269.71 | 400.61 | 333.55 | |
Leaf_tc_dof-miR33-5p | AGGUAUUGGCGUGCCUCAAUC | Identical to miR171 | 0.49 | 15.29 | 10.73 | 3.28 |
Leaf_tc_dof-miR33-3p | UUGAGCCGCGUCAAUAUCUCC | 5.68 | 111.02 | 42.38 | 68.30 | |