Skip to main content

Advertisement

Table 1 Example of the output table showing the expression values and sequence conservation of the mature microRNAs predicted in Dendrobium officinale

From: PmiRDiscVali: an integrated pipeline for plant microRNA discovery and validation

Mature ID Mature sequence Conservation Mature expression (RPM)
Flower Leaf Root Stem
Leaf_tc_dof-miR8-5p AAGCGAAUCCGGACGUGUCACGUC 0.73 3.27 1.86 1.15
Leaf_tc_dof-miR8-3p UGUGGCGCGUCCGGAUUCGCCUCC 0.00 0.13 0.00 0.00
Leaf_tc_dof-miR36-5p UCGCUUGGUGCAGGUCGGGAC Identical to miR168 222.74 107.83 70.50 132.34
Leaf_tc_dof-miR36-3p CCUGCCUUGCAUCAACUGAAU 412.69 255.38 241.41 469.93
Leaf_tc_dof-miR1-5p UGGAAGGGGCAUGCAGAGGAGC Similar but not identical to miR528 183.19 2066.05 2511.72 3565.33
Leaf_tc_dof-miR1-3p UCCUAUGUAUGCCUCCUCCACU 9.64 269.71 400.61 333.55
Leaf_tc_dof-miR33-5p AGGUAUUGGCGUGCCUCAAUC Identical to miR171 0.49 15.29 10.73 3.28
Leaf_tc_dof-miR33-3p UUGAGCCGCGUCAAUAUCUCC 5.68 111.02 42.38 68.30