Skip to main content

Table 1 Primer sequences used for amplification of different LINC01420 loci and reference genes and siRNA sequences used for knockdown

From: LINC01420 RNA structure and influence on cell physiology

Primer Sequence
F1 5′ - GCCCACCGGAGAAAACTGAC – 3
R1 5′ – CCTTCCGGATAATCCCAACG - 3‘
R1–1 5′ – GAGGCTTGGCTTCCCGTG - 3‘
R1–2 5′ – TTCCAGGTGGGAGAGTGGA – 3
F2 5′ – AGTGATTGCAGTATGACTCCA - 3‘
R2 5′ – TTCCAGGTTCAGGACACCAGA - 3‘
F3 5′ – TCAGCGCGATTTCACTTCCTG – 3’
F3–1 5′ – CTGAATTTCGATGAATTCTAAGAC – 3’
F3–2 5′ – ACCTCTGAGATTTAAGGCCATG – 3’
R3 5′ – GACCATCTCACAGGCATTGTT – 3’
F4 5′ – GTACACTTTCTTTAATTTGCTGTC – 3’
F5 5′ – GAAAATGTCAGATAAACTTGGCT – 3’
R5 5′ – CTTTAATTCTGATGCTAGGGACT – 3’
HPRTf 5′ – TGTAATGACCAGTCAACAGGG - 3’
HPRTr 5′ – TGCGACCTTGACCATCTTTG - 3’
B2Mf 5′ – TCTTTCAGCAAGGACTGGTC - 3’
B2Mr 5′ – GGCATCTTCAAACCTCCATG - 3’
TBPf 5′ – CGGAGAGTTCTGGGATTGTAC - 3’
TBPr 5′ – GTGGTTCGTGGCTCTCTTATC - 3’
TFRCf 5′ – TCCTTGCATATTCTGGAATCCC - 3’
TFRCr 5′ – ATCACGAACTGACCAGCG - 3’
siLINC01420 5′-UCCGGAGAAGUAGAGAAAUdTdT-3′/
5′-AUUUCUCUACUUCUCCGGAdTdT-3′
siEIF3D#1 5′-GCGUCAUUGACAUCUGCAUdTdT-3′/
5′-AUGCAGAUGUCAAUGACGCdTdT-3′
siEIF3D#2 5′-CGACAUGGAUAAGAAUGAAdTdT-3′/
5′-TTCATTCTTATCCATGTCGdTdT-3’
siControl 5′-AGGUAGUGUAAUCGCCUUGdTdT-3′/
5′-CAAGGCGAUUACACUACCUdTdT-3′
FAM-control 5′-FAM-AGGUCGAACUACGGGUCAAdTdT-3′/
5′-FAM- UUGACCCGUAGUUCGACCUdTdT-3′