Skip to main content

Table 2 Primers and probes used for qRT-PCR

From: Enrichment post-library preparation enhances the sensitivity of high-throughput sequencing-based detection and characterization of viruses from complex samples

Virus Forward Primer Sequence Reverse Primer Sequence Probe Sequence Reference
CHIKV (181/Clone 25) AGCTCCGCGTCCTTTACCA GCCAAATTGTCCTGGTCTTCCT Express One SYBR Green I (Life Technologies) [30]
DENV-1 (TH-SMAN) GACACCACACCCTTTGGACAA CACCTGGCTGTCACCTCCAT FAM-AGAGGGTGTTTAAAGAGAAAGTTGACACGCG-TAMRA [31]
DENV-2 (New Guinea C) ACAGGCTATGGCACTGTTACGAT TGCAGCAACACCATCTCATTG FAM-AGTGCTCTCCAAGAACGGGCCTCG-TAMRA [32, 33]
IFV-A – HA (A/Swine/Iowa/15/30) CCAGTCACAATAGGAGAGTG AAACCGGCAATGGCTCCAAA Express One SYBR Green I (Life Technologies) [34]
ZIKV (MR766 and R116265) AARTACACATACCARAACAAAGTGGTa TCCRCTCCCYCTYTGGTCTTG Express One SYBR Green I (Life Technologies) [35]
  1. aboldface T was modified from originally published R