Skip to main content

Table 5 RT-qPCR primer sequences

From: Purification of high-quality RNA from a small number of fluorescence activated cell sorted zebrafish cells for RNA sequencing purposes

gene forward primer reverse primer
tdr7 GCAGCATAATTGAGTACACCC TTGCCTATATTCACTGAGAAATGGA
hatn10 ACTAATGAAGACAGCAGAAGTCA CAGTAAACATGTCAGGCTAAATAAT
loopern4 TGAGCTGAAACTTTACAGACACAT AGACTTTGGTGTCTCCAGAATG
flia GGGCTCCACTGAAAATTGCG CTGGCCGTAATCCTGAGTCC
lck ACATGTCTTTGAAACACGCCG GCAGTTCCCCATGTTTACGTATTT
GFP ACACTGACCAAGAGCTACCTTC GTTTTGGCCAGCCCTTTTGT
EGFP GACCACATGAAGCAGCAC TTGTCGGCCATGATATAGAC