Skip to main content

Table 1 List of primers used for RT-qPCR analysis

From: Systematic identification and validation of the reference genes from 60 RNA-Seq libraries in the scallop Mizuhopecten yessoensis

Gene ID Accession No. Gene Name Primer Sequence (5′-3′) Amplicon Length (bp) Amplification efficiency
PYT16215 XM_021518643.1 RS23 F:TTACACGAATATCCGCCATCA 100 1.05
PYT23375 XM_021500266.1 EF1A F:GCGGTGGTATTGACAAGAGA 113 1.04
PYT15332 XM_021490269.1 NDUS4 F:TGTGAGAAGCTGGTGTGCTA 108 1.00
PYT08134 XM_021506528.1 SELR1 F:AAGGCTGGATCAGCGTACTT 97 1.04
PYT12324 XM_021496512.1 EIF3F F:TGCTTCGCTGTGCCTCATAA 105 1.04
PYT24193 XM_021485429.1 OLA1 F:AAGGTCAAGGTCTCGGCAAT 100 1.02
PYT04221 XM_021511578.1 ACT F:GACAGCTACGTAGGAGATGA 112 1.02
PYT19918 XM_021485125.1 HEL F:CAGGAAGCAGTGGACTTACA 100 1.02
PYT19808 XM_021522100.1 EF1B F:TAGGCCAGTATGGACCTTCA 105 1.05
PYT03203 XM_021484929.1 RPL16 F:GTTATCTTCAGTACGCTCACA 103 1.00