Skip to main content

Advertisement

Table 2 The primers’ sequences of 22 genes for PCR analysis in this study

From: Comparative transcriptome analyses of genes involved in sulforaphane metabolism at different treatment in Chinese kale using full-length transcriptome sequencing

Genes ID Gene and symbol Primers sequences (5′-3′)
Forward Reverse
CDX99400.1 (cytosine-5)-methyltransferase CMT2 (DNMT2) GAACGACGATGCTGAAGGTAG CTGCTGCTGAGACTCTGACTA
CDY40532.1 S-adenosylmethionine synthase (SAMS) AAGCCGCCACATAAGAGACTA ACAGGACAAGAACAGACAGACT
XP_009111749.1 Uncharacterized CCTGCCGTGTTGTCTTCC GCTCTGTGGTTGTTCATCATCT
CDY19364.1 (cytosine-5)-methyltransferase CMT1 (DNMT1) TGGATGGTGGAGATGCTTCA CGTTCAAGGTCGTCGTCATT
CDX85436.1 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1 (metE) ATGCTCGGTGCTGTTCCA GCCTTGTGCGATGCGTAA
CDX80735.1 cytochrome P450 83B1 (CYP83b1) TTCACCGCTCGTCCTCTC ACCATACACATCTTCCTCATCTCA
CDX69373.1 cytochrome P450 79B1 (CYP79b1) TTCGGATCTCACTTCCACTACA CATCACCAAGGTTATAGCCACAA
CDY01177.1 adenosylhomocysteinase 1 (SAHH) CCGTCACCAAGAGCAAGTTC CATCACCATATCCGCAGACAAC
XM_009134853.1 S-adenosylmethionine synthase 3-like (SAMS3L) GCACGCCGCTGTATAGTC ACACGAGTATATCCTTGTCTGGTA
XP_009141614.1 S-adenosylmethionine synthase 3-like (SAMS3L) GACAAGACCATATTCCACCTCAAC GCCTGCCTAACGATGTAAGC
XP_009107632.1 cytochrome P450 83B1 (CYP83b1) TGAGATGAGGAAGATGTGTATGGT ACAGTTGGTGAATGACAAGAGAAG
CDY12709.1 cytochrome P450 83A1 (CYP83A1) GGCGATGCTTGAGGTTCC GCTTGAGATGATCCGACTTGTG
XM_009138817.1 methylthioalkylmalate synthase 2 (MAM2) CTATCGTTATGGCTTCGTCACTTC CGTAGGGAGGGCAAGGAA
XM_009103756.1 S-alkyl-thiohydroximate lyase SUR1 (SUR1) TCTCACGACCATCTCCACAA TCCAGCCAATCTTCCATCCA
ACB59204.1 UDP-glycosyltransferase 74B1 (UGT74B1) CGACGCATACTCCGAATCC GGTGAGGTTGTTGGTGAAGAA
CDX75914.1 S-adenosylmethionine synthase 2 (SAMS2) CTGAGCCGTTGTCTGTGTT ACCATAAGCAGCAGTCTTCAAG
CDY37784.1 S-adenosylmethionine synthase 2-like (SAMS2L) GTTCAGGTCTCTTACGCCATTG TGTCCATACGCAGCAGTCT
DQ679980.1 homocysteine S-methyltransferase 1 (HMT1) TTGGTGATGCTGAGTTTGAGAT TTGATGGTGGAAGGTGTAGTC
CDX73052.1 cytosolic sulfotransferase 16-like (SULT16L) GGACACTGGTGGCAAGAATG AGCGAGAACGGTTGACGATA
XP_009106322.1 adenosylhomocysteinase 2-like (SAHH2L) GCTCACCAAGGACCAATCTG ACCCGAACCAACTCAAACAAT
AAP92453.1 adenosylhomocysteinase 1-like (LOC106311804), transcript variant X1 (SAHH1L-X1) GCTGGTGCTAGAGTCATTGTG GCGTTGTTCTTCATCTTCCTCAT
XP_009135865.1 adenosylhomocysteinase 2 (LOC106335699), transcript variant X4 (SAHH2L-X4) CGTGATGTCGTGCTCGTT CTTCTCGTCCAAGTGCTTAGG
XP_009114068.1 S-adenosylmethionine synthase 2-like (SAMS2L) GAGGTGGTAATGGTAGGTTCTTG CTTGTTAGACTTGAGTGGCTTCA