Skip to main content

Advertisement

Table 3 Female-specific primers

From: Genome-wide RAD sequencing to identify a sex-specific marker in Chinese giant salamander Andrias davidianus

Primer Sequence (5′-3′) Annealing temperature (°C) Product size (bp)
adf225s CCATGCCCTGTACATTTGCG 59.899 162
adf225a CCGTGAACATGGAGGGGTTT 60.251  
adf340s TTAACGGCCCTAACACCAGG 59.674 251
adf340a GGTTTAGGGCGGCTCTGATT 60.107  
adf318a TATGTCAGGGTGATCAAACTCTTCA 59.5 266
adf318s CTAGAAGACGTGGTGGCCATG 60.0  
adf431a TCCAGAATGAAGTCCTGGCCT 59.1 178
adf431s CGAGCCTCCATTGTGCCTT 59.8