Skip to main content

Table 6 Antisense oligonucleotide sequences designed for targeting highly abundant transcripts in the mammary gland

From: Development and evaluation of a milk protein transcript depletion method for differential transcriptome analysis in mammary gland tissue

Gene name Accession number Oligonucleotide name Oligonucleotide sequence (5′-3′)
PAEP NM_173929.3 LGB_R5 GGGCTCACCTAGATGTGGCACTGCTC
LGB_R6 GCTCAGCACTGTTCTCCATGCAGAAG
LALBA NM_174378.2 LALBA_R6 GTCATCAGTAAGATCATCATCCAGGAAC
LALBA_R7 CAGAACAGAGTGCTTTATGGGCCAACC
CSN1S2 NM_174528.2 CSN1S2_R3 ATAACCAGGTAGAAGCAGTTAATTCCAG
CSN1S2_R4 ATGCTGGTTGTATGAAGTAAAGTGGTAG
CSN1S1 NM_181029.2 CSN1S1_R7 TCAGAATTCACTTGACTCCTCACCACAG
CSN1S1_R8 TAGGATTAGGGATGTCAGAGAATGATGG
CSN3 NM_174294.2 CSN3_R6 GTAAGAGGAGACGAGGAAGGAGCCAG
CSN3_R7 ACTGTGTTGATCTCAGGTGGGCTCTC
CSN2 XM_010806178.1 CSN2_R4 TCCAGTCGCAGTCAATTCAAAAGTGAG
CSN2_R5 CTTTCTGGGGAACAGGCAGGACTTTG