Skip to main content

Table 1 Primers used and the product sizes of the eight target genes examined in the quantitative PCR.

From: Genome sequencing provides insights into the evolution and antioxidant activity of Chinese bayberry

Gene mRNA No. Left primer Right primer Product size
MRNA_008272_1 AACGGACGGATGGTAGAGGA TGATCTTCTCGCGCATCCTC 136
MRNA_011576_1 AGAGCCTTTTGCAGAGCGAT GCTCCTTCATGGCTTCAGGT 84
MRNA_004300_1 GCGGCTGCTGTCATAATTGG AATGTAAGCCCCACCTCACG 140
MRNA_014338_1 CTTCCACCTGGCCCTAAAGG GAGGCCACGACCATGTTACA 146
MRNA_026243_1 TGATTGACGCAATCCAACGC TCCACGTGCTTTTTGCTAGC 112
MRNA_022650_1 AGTGTCGCTTCTTTGGCAGA TCAATTGGAGCTCCTGCCTG 134
MRNA_015875_1 GGGAGGTTCAAGAGCGTGAA TGGCCCTCCGAAGTAGATCA 81
MRNA_011718_2 CTCTTGGCAAGGATGGACGT GTAGCAGCTCCCCCACAATT 81
MRNA_021433_1 AAGGCGAAGATCCAAGACAA GTGGAGCGTCGACTCTTTCT 116