Skip to main content

Table 3 Oligonucleotide primers used in the study

From: Optimized PCR conditions minimizing the formation of chimeric DNA molecules from MPRA plasmid libraries

Primer name Sequence 5′ → 3′ Notes
Libr-A1-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG TTCGGAGT GACACTCGAGGATCGAG Illumina sequencing primer sites “seq1” and “seq2” are underlined by single and double lines, respectively.
Libr-A2-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG ACTCATTT GACACTCGAGGATCGAG
Libr-A3-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GGGATCCG GACACTCGAGGATCGAG
The 8-bp sample index (“i”) sequences are in bold.
Libr-A5-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CAAGATAA GACACTCGAGGATCGAG
“Target specific forward” and “target specific reverse” sequences immediately flanking BC and ROI are in italic.
Libr-A6-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GGACAACG GACACTCGAGGATCGAG
Libr-A7-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG AGCGAGCT GACACTCGAGGATCGAG
Libr-A8-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CTGCACGT GACACTCGAGGATCGAG
Libr-A9-for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GCACTAGT GACACTCGAGGATCGAG
Libr-rev GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG CCCTAGAAAGATAATCATATTGT
Libr-P5-for AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC Illumina “P5” and “P7” adapters are underlined by single and double lines, respectively.
Libr-P7-rev CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
BC1 ACTAGGCAAGGCACCAG  
BC2 CGAGGGATATAGAGCGAGTTAA  
ROI1 TACGTTAAAGATAATCATGCATAAGTCG  
ROI2 TACGTTAAAGATAATCATGCTATATGGC  
Illumina-qPCR-1 AATGATACGGCGACCACCGA KAPA Library Quantification Kit (Roche).
Illumina-qPCR-2 CAAGCAGAAGACGGCATACGA