Skip to main content

Table 3 Primers used for RT-PCR in the present study

From: Dynamic DNA methylation of ovaries during pubertal transition in gilts

Name Sequence Product(bp) Accession number
DNMT1 F: GGGAGATGTGGAGATGCTATGC 271 NM_001032355.1
R: TGCTGGTACTGAAGCGGTTG
DNMT3a F: GCGAAGTGAGGACCATTACTACGA 126 NM_001097437.1
R: AGCCGAACACCCTTTCCATCT
DNMT3b F: GAGCGTAGAAGCAAGGAAACAC 332 NM_001348900.1
R: CTGGCAGCCGTCATCGTCATA
ESR1 F:GATGCCTTGGTCTGGGTGAT
R:AGTGTTCCGTGCCCTTGTTA
124 NM_214220.1
FGF21 F:CACGAAACTGAAGCCCACCTG
R:TTGTAGCCATCCTCAAGAAGC
165 NM_001163410.1
GSK3B F:AACCACCTTCTTTGCGGAG
R:GCTTGGCTTGATACACGACA
214 NM_001128443.1
IGF1R F:AGAACTGCACGGTGATCGAG
R:AGATGACCAGGGCGTAGTTG
178 NM_214172.1
TAC3 R:GACTTCTTTGTGGGTCTTATGG
F:GCAGTTTCTACAGACGGTGG
283 NM_001007196.1
MMP2 R:GATGGCTTCCTTTGGTGTTCC
R:CTTCTTGTCGCTGTCGTAGTCC
318 NM_214192.2
GAPDH F:TCCCGCCAACATCAAAT
R:CACGCCCATCACAAACAT
253 NM_001206359.1