Fig. 2

Examples of outputs. a: Summary table. The first six columns are for the stem-loop precursor. Reads is the number of reads that are mapped to the locus (when this number fulfils criterion 2, it is highlighted in turquoise), reads distribution is the total score achieved by criteria 4–6, mfei is the MFEI of the secondary structure of the precursor (when its value is smaller than − 0.8, it is highlighted in pink, in accordance with criterion 1). The four last columns are for the miRNA. Sequence is the sequence of the guide miRNA, when its exists (criterion 3), and length is its length. Weight is the number of reads corresponding to the miRNA normalized by the total number of occurrences of the sequence in the genome. Alignment indicates if there is an alignment with mature plant miRNAs in miRBase. This cell is checked when such an alignment is found, and doubled checked if it overlaps the miRNA locus in the precursor. b: Read cloud. The read cloud is the visual representation of a candidate miRNA precursor. The first line is the sequence of the precursor. The second line is the stem-loop structure in bracket-dot format. The third line with square brackets and dots highlights the miRNA duplex (when the miRNA is well-defined). The fourth line indicates the position of the alignments with the miRBase sequence, when found. In the remaining lines, each ********** string is a unique read. Its length and its depth (its number of occurrences in the set of reads) are reported at the end of the dotted line. The mature miRNA, when one is defined, is written in full letters. In this example, the locus has a total of 114 reads, corresponding to 7 unique reads. The most frequent read is AGAUAUUAGUGCGGUUCAAUC, with 71 copies (representing 62% of reads). Following criteria 3, it is selected as the guide miRNA. Its length is 21 nucleotides. The passenger miRNA is UUGAGCCGUGCCAAUAUCACG, supported by 27 reads. As expected, its position is shifted by two nucleotides compared to the guide miRNA. Lastly, we found two distinct alignments with miRbase, whose positions coincide to the guide and the passenger miRNAs respectively, which is a good indicator that the miRNA duplex is evolutionary conserved