Skip to main content

Advertisement

Table 3 Summary of newly identified novel miRNAs in the 12 wheat sRNA libraries

From: The genome-wide impact of cadmium on microRNA and mRNA expression in contrasting Cd responsive wheat genotypes

ComparisonmiRNA_idlog2 (Fold Change)PDownMature sequence(5'-3')Length
L17Cd/L17CK2B_20696a1.690.0270291UpCUCGCCGGUCGCGCGUCCUCC21
2B_21940a2.330.0462198UpAUGACACGGGGAGGUAGC18
2B_39534a6.110.0176417UpAGGCUGGAGGAACGUAGG18
2B_40590a2.000.0383352UpGUGUGGAGCAAAAGGGUG18
4B_10717a4.180.0021475UpCCCCGGGUGCGAGCUCCU18
4B_12465a5.450.0221443UpCCUCCUGGUGAGCCUGCG18
4B_4791a1.960.0091409UpUGGGGUUGUGGCAAUGGCC19
4B_519a2.400.0050086UpAAUCUGGUUGUCGCCUCC18
4B_5711a4.200.0024414UpGUGAAGAGACAUGGAGGU18
4B_9306a1.130.0050015UpUAGAAUGGCUGGUGCUAUGGA21
2B_19887a-4.180.0352225DownACGGACCGCGCUACUACUAUAAGU24
2B_22021a-1.390.016954DownAUGGAAGACGUGGUAGCC18
2B_28100a-1.270.0412731DownAGGUAGAGAGGAAGGUGGG19
2B_33543a-3.400.0480069DownCUCGCCGGAGGAGCGUGC18
2B_38598a-2.150.0214449DownCUGCUGGUGCUGUAGCCCU19
4B_17875-4.360.0138807DownUUCCAAUUUACUCGUCGUGGU21
4B_4344a-2.680.0327648DownGGUGUGGACCAGGUUUCC18
4B_87a-4.350.0106819DownCGCGUGCAGGAUGAAGCC18
4B_8797-2.080.0458935DownACUCACUCUGUAAACUAAUAUAAG24
H17Cd/H17CK2B_19349a4.001.83E-06UpAAACAGUCUGUAAAGCCCC19
2B_20999a2.421.06E-14UpCUACGGGGGAAAGCAGGG18
2B_21614a2.020.0023063UpUGUUGAAGUAGCUGGAAC18
2B_21995a1.410.002425UpCGGAGAGGGGAGUGAAGU18
2B_22021a2.939.43E-27UpAUGGAAGACGUGGUAGCC18
2B_22879a3.190.0120242UpCGGCCAUCGUGAGGUUAGUGC21
2B_25173a2.360.0000977UpGACUUUGAUCCAGAGAUCA19
2B_27180a1.860.0252563UpGUUGGUCGGGAGUUCGAUCCU21
2B_28100a1.764.01E-07UpAGGUAGAGAGGAAGGUGGG19
2B_28714a1.460.0001773UpAUGAGAGGACGGACAAGG18
2B_29589a1.980.0040311UpGAGUUUGGGAGUCUGUGUGU20
2B_321481.660.0364154UpUCAGUGCAAUCCCUCUGGAAU21
2B_33858a1.580.0226808UpCGUGCCAGCAGCCGCGGA18
2B_37122a1.330.0002491UpUCUGGUGGAUGCCUUGGG18
2B_37173a1.150.0031618UpAGAGGGUGGUGGAGUUUCU19
2B_38197a5.031.57E-10UpUUGUUGGAUAUGUUGGUU18
2B_40139a2.060.0018813UpGUGGAUGCCUUGGCGAUC18
2B_40352a2.740.0074044UpCAAUGGUAGAGCAGAGGC18
2B_42257a1.930.0031222UpGGCGGCGGACGGGUGAGC18
2B_42905a0.910.0142497UpGAGGUGCUGCAUGGCUGG18
2B_43522a1.910.0003365UpUGAGGUUUGAGAGGGGCU18
4B_10203a1.290.0034214UpGAGGCGAUGAAGGACGGG18
4B_10621a1.880.0391309UpGGGUGAAGCUGUGGCGCG18
4B_10870a2.946.11E-06UpUGGUUCUGUAUGGAAGUG18
4B_12067a1.140.0151284UpAUGAACGCUAGCGGGAGG18
4B_12312a3.380.0022606UpGAGUGGUCGAGCGGGACGG19
4B_13500a2.410.0044361UpGGUUCUGUAUGGAAGUGG18
4B_13640a1.370.0041213UpAGGUCUGGGUUCGAGUCC18
4B_1373a2.420.0134111UpGCUUGUCGCUGGUUUGAG18
4B_15373a0.920.0420051UpGUGGCUCCACGUGGGCGGGC20
4B_15496a1.630.0036066UpUGCGGGAUGGAGCAGUCG18
4B_15927a2.372.51E-08UpAUGCUAGUCGAGCGGAUA18
4B_16269a3.223.8E-11UpAGGUCGACGGUUCGAAUCC19
4B_16562a1.340.0445484UpCGGAGGUCGCGGGUUCGA18
4B_16625a1.940.0000161UpUCCUGGGGUUGGAGAAGG18
4B_18394a1.240.007484UpGCGGCGAGAGCGGGUCGCU19
4B_1943a1.850.0000179UpACAGUGGAUGCCUUGGCA18
4B_2104a1.610.0136994UpAAGCCUCUGGCGAAUGGG18
4B_2324a3.280.0050367UpGAUUUAUCGGGGAAGGAU18
4B_2847a3.910.0001901UpGAGGAAGGUGGAUGACGG18
4B_4039a3.730.0200414UpGAACGGAAGUUGGGGGCG18
4B_4609a3.460.0000312UpGAUCUUGAUGUGGUGUGCA19
4B_4703a2.741.23E-07UpGUGAUUCAGCGGCGGACG18
4B_5897a1.350.0138282UpAGGAGGGUGGGGAUGAGGU19
4B_5947a2.750.0124835UpGAGUGGUCGAGCGGGACGG19
4B_6530a2.053.8E-10UpGCUCGUGUCGUGAGCUGG18
4B_841a1.640.0087137UpGAAGGUCGUGGGUUCGUG18
4B_88a3.200.0471916UpAGACGUUUCCGUCGACUACGAAA23
4B_974a1.790.0009387UpUAUCGUGGGUUCGAAUCC18
2B_19630a-1.520.0134799DownCAGCCUGCCAACCCUGGG18
2B_23520a-5.383.24E-07DownGCUUCGGCGGUAUCCUCAU19
2B_27285a-1.720.0294342DownGAUGGGUCUCUGAGGGAU18
2B_40624a-1.930.0212515DownUGGCGAUGAGGAACGGAA18
2B_40888a-2.070.0151122DownGGCGGAGGCUGCGGGUUU18
4B_11590a-2.330.0093351DownGAGGGGUGUUGAUUUUCCGG20
4B_7298a-1.770.0132316DownGAGGGGUGUUGAUUUUCCGG20
4B_7309a-2.870.0008129DownGAACGGAAGUUGGGGGCG18
  1. aHighly conserved miRNAs