Skip to main content

Advertisement

Table 2 QRT-PCR primers used in verification of avian microRNAs MicroRNA array results

From: Microarray analysis of infectious bronchitis virus infection of chicken primary dendritic cells

MiRNAs Sence primer
gga-miR-2131-3p GGTGCTGTTACTGTTCTTCTGATGG
gga-miR-1462-3p GTATCTGTCCTTGTGAGCCCCAG
gga-miR-21-5p GCGTAGCTTATCAGACTGATGTTGA
gga-miR-1694 TAATAAAGGAGGACGAGGCTGCGAGC
gga-miR-1607 AATTAATTATAGGGGCGGGAGGGGTCG
gga-let-7 g-5p TGGGTGGGTGAGGTAGTAGTTTGTACAG
gga-miR-19a-5p GCGAGTTTTGCATAGTTGCACTAC
gga-miR-1797 GCTTGGAACTGAGCAGGAACTG
gga-miR-20a-5p CGGTAAAGTGCTTATAGTGCAGGTAG
gga-miR-106-5p CGGAAAAGTGCTTACAGTGCAGGT
gga-miR-1595-5p AAGCACGAGTGTGGTGGAGCTC
gga-miR-122b CGGAGTGTGACACTGGTGTTTTT
gga-miR-1624 TAATACACCGCACTGGCAGGGA
gga-miR-1809 GTGGGAAGTTTGGCAGAGCAT
gga-miR-24-3p TGGCTCAGTTCAGCAGGAACAG
gga-miR-1816 GTGGGTAGGTTTTGTGGTTTTGTT
gga-miR-456-3p GGCAGGCTGGTTAGATGGTTGTC
gga-miR-1601 AGTGTGAGCAGGTGCAGAGCTG