Skip to main content

Advertisement

Table 3 Differentially expressed predicted miRNAs and barley mapped reads with homology to miRBase miRNAs

From: Small RNA discovery in the interaction between barley and the powdery mildew pathogen

Predicted miRNA or read Sequence miRBase match Number of predicted barley copies DE time points (and log2 fold changes) miRBase blastn overlap Mis-matches
DE barley mapped read TCGGACCAGGCTTCATGCCCC miR165 NA bln1 16 HAI (-2.55) , bln1 20 HAI (-2.39), mla6 20 HAI (-1.77), rar3 20 HAI (-2.14), bln1 24 HAI (-2.47), mla6 24 HAI (-2.02), bln1 48 HAI (-2.41), mla6 48 HAI (-1.78) 1
DE barley mapped read TTCGGACCAGGCTTCCTTCCC miR166 NA mla6 48 HAI (1.92) 2
DE barley mapped read TGGGACCAGGCTTCATTCCCC miR166 NA bln1 20 HAI (-2.24), rar3 20 HAI (-1.71) 1
DE barley mapped read TCGGACCAGGGTTCATTCCCC miR166 NA bln1 48 HAI (-2.31), mla6 48 HAI (-1.80) 1
DE barley mapped read TTCGGACCAGGCTTCAGTCCC miR166 NA rar3 48 HAI (-2.10) 2
DE predicted miRNA ACACAAACCGGGACTAAAG miR2120 9 mla6 20 HAI (1.59) 2
DE predicted miRNA GTGTTCTCAGGTCGCCCCCGC miR398 2 mla6 32 HAI (2.03) 1
DE predicted miRNA AGAACAGAGAATGGCGATAGACTC miR398 1 mla6 0 HAI (1.63), mla6 20 HAI (1.72), mla6 24 HAI (1.66), mla6 48 HAI (1.93) 4
DE barley mapped read TGTGTTCTCAGGTCGCCCCCG miR398 NA mla6 24 HAI (1.71), mla6 32 HAI (2.57) 0
DE predicted miRNA TCCTGTGCCTGCCTCTTCCAT miR528 1 mla6 20 HAI (1.97), mla6 24 HAI (2.27), mla6 32 HAI (2.18) 1
DE barley mapped read TCCTGTGCCTGCCTCTTCCAT miR528 NA mla6 24 HAI (2.07), mla6 32 HAI (2.19) 1
DE barley mapped read TGGAAGGGGCATGCAGAGGA miR528 NA mla6 32 HAI (1.86) 0
DE barley mapped read TGGAAGGGGCATGCAGAGGAG miR528 NA mla6 16 HAI (2.20), mla6 20 HAI (2.40), mla6 24 HAI (2.21), mla6 32 HAI (2.09) 0
DE barley mapped read CCTGTGCCTGCCTCTTCCATT miR528 NA mla6 0 HAI (1.99) 0
DE predicted miRNA ATTTTGCTTCGTATGTAGACT none 17 mla6 0 HAI (1.97) none NA
DE predicted miRNA TATTAGTTGACAGAGGGAGTA none 5 mla6 48 HAI (-1.77), mla6-bln1 48 HAI (-2.44), bln1 48 HAI (-2.40) none NA
DE predicted miRNA AACTAGTACTACTCTAATGTGCCT none 3 mla6 0 HAI (-1.07) none NA
DE predicted miRNA GCTTTCATAGCTCAGTTGGTTAGAGCACCCG none 1 bln1 32 HAI (1.64) none NA
DE predicted miRNA AATTTGAACTGTGAAACT none 1 mla6 0 HAI (1.46), mla6 20 HAI (1.76), mla6 24 HAI (1.56) none NA