Skip to main content

Advertisement

Table 4 Primers of Foc used for quantitative reverse transcription PCR

From: Transcriptome analysis of virulence-differentiated Fusarium oxysporum f. sp. cucumerinum isolates during cucumber colonisation reveals pathogenicity profiles

Gene Predicted function Primer (5′-3′) Product length (bp)
Unigene9558_All Putative fumarate reductase F:CGAGCTCCTTACCGGTCATC 108
R:TCCCCATTCGCCTTGTTCTC
Unigene9396_All NADH-ubiquinone oxidoreductase F:AGGAACACTCGCATTACCCG 108
R:AAAGTACTGCCTCGACGCAA
Unigene9029_All ATP-binding cassette F:TGCGGATTTTGTGGTGCTTG 137
R:AGGAGCAAGCTGCCATTGAT
Unigene6200_All Transporter F:TAGAGGGTCTGGACTTGCGA 150
R:GCGTCGCCACATCTTCAATC
CL2721.Contig2_All Zinc finger protein F:GATCCTGCAACGTCGCAATC 129
R:TCGCCATGTCGGATAAGCTC
Unigene11126_All Six11 F:GGCTTCGGGTCTCGTTTACA 199
R:TCGTACGCAATTCATCCCGT
Unigene9119_All Aldose 1-epimerase F:CTGATCGACGACCAGTACGG 104
R:GGAACACCTCCAAGATGGGG
Unigene10703_All Aldehyde dehydrogenase F:AGGGCAGAGAGAGGAGTCTG 151
R:ACTACACCCGATCTGAGCCT
Unigene751_All Transglycosylase F:CTTAACCATCTCGGCGTCGA 104
R:GTATCCACCGATCCCACGTC
Unigene7301_All Peroxisomal F:ACCAGCGAGAATGTCAGCAA 118
R:TCTCATCGGCGAACAAACCA
CL3376.Contig1_All Transport protein F:CCCAAGTACGGCAACATCCT 129
R:GTTGACCGAGGCCTTGTGTA
Unigene1756_All Acyl-CoA dehydrogenase F:GAGTGTTGGTTCCAGAGCGA 196
GAGATCGTTGTCGCGAGGAT
EF1α F:CATCGGCCACGTCGACTCT 144
R:AGAACCCAGGCGTACTTGAA