Skip to main content

Advertisement

Table 3 List of novel miRNAs discoveries and their information

From: Regulation of terpenoid biosynthesis by miRNA in Persicaria minor induced by Fusarium oxysporum

ID miRNAa miRNA sequence (5′ to 3′) Pre-miRNA IDb Length of precursors (nt) ID transcriptc % A and U MFE (kcal/mol)d AMFEe MFEIf
Pmi-nov_12 AAAGAGGAAGTGAAAGTGAA Pre-nov_12 143 comp65772_c1_seq1 58.04 −46.40 32.45 1.30
Pmi-nov_13 GAGGAGTTGGTGGAGGAA Pre-nov_13 113 comp63496_c0_seq5 35.40 −49.10 43.45 1.49
  1. amiRNA identification
  2. bPre-miRNA identification;
  3. cTranscript identification
  4. dMinimum folding energy
  5. eAdjusted minimum folding energy
  6. fMinimum folding energy index