Table 3 List of novel miRNAs discoveries and their information
From: Regulation of terpenoid biosynthesis by miRNA in Persicaria minor induced by Fusarium oxysporum
ID miRNAa | miRNA sequence (5′ to 3′) | Pre-miRNA IDb | Length of precursors (nt) | ID transcriptc | % A and U | MFE (kcal/mol)d | AMFEe | MFEIf |
|---|---|---|---|---|---|---|---|---|
Pmi-nov_12 | AAAGAGGAAGTGAAAGTGAA | Pre-nov_12 | 143 | comp65772_c1_seq1 | 58.04 | −46.40 | 32.45 | 1.30 |
Pmi-nov_13 | GAGGAGTTGGTGGAGGAA | Pre-nov_13 | 113 | comp63496_c0_seq5 | 35.40 | −49.10 | 43.45 | 1.49 |