Skip to main content

Table 3 The miR156 target information of Euphorbiaceae SBP genes

From: Genome-wide identification, phylogeny, and expression analysis of the SBP-box gene family in Euphorbiaceae

Location ID CDS/3’UTR length Target site miR site
CDS JcSBP1 1014 818 GUGCUCUCUCUCUUCUGUCA 837 20 CACGAGAGAGAGAAGACAGU 1
CDS JcSBP2 1590 1148 GUGCUCUCUCUCUUCUGUCA 1167 20 CACGAGAGAGAGAAGACAGU 1
CDS JcSBP3 954 683 GUGCUCUCUCUCUUCUGUCA 702 20 CACGAGAGAGAGAAGACAGU 1
CDS JcSBP5 1443 1154 GUGCUCUCUCUCUUCUGUCA 1173 20 CACGAGAGAGAGAAGACAGU 1
CDS JcSBP13 1725 1289 GUGCUCUCUCUCUUCUGUCA 130 20 CACGAGAGAGAGAAGACAGU 1
CDS JcSBP14 1119 230 AAGGGUGUAAAGUGGAUCUGA 250 21 UACCCAUAAUUCAUCUAGACU 1
CDS JcSBP15 1260 830 GUGCUCUCUCUCUUCUGUCA 849 20 CACGAGAGAGAGAAGACAGU 1
3’UTR JcSBP7 237 150 CUGCUCUCUCUCUUCUGUCA 169 20 CACGAGAGAGAGAAGACAGU 1
3’UTR JcSBP8 530 4 UGCUCCCUCUCUUCUGUCAU 23 20 ACGAGAGAGAGAAGACAGUU 1
3’UTR JcSBP10 214 25 UGCUCCCUCUCUUCUGUCAU 44 20 ACGAGAGAGAGAAGACAGUU 1
CDS RcSBP3 1149 968 GUGCUCUCUCUCUUCUGUCA 987 20 CACGAGAGAGAGAAGACAGU 1
CDS RcSBP5 1674 1229 CUGCUCUCUCUCUUCUGUCA 1248 20 CACGAGAGAGAGAAGACAGU 1
CDS RcSBP11 1155 884 GUGCUCUCUCUCUUCUGUCA 903 20 CACGAGAGAGAGAAGACAGU 1
CDS RcSBP12 1452 1163 GUGCUCUCUCUCUUCUGUCA 1182 20 CACGAGAGAGAGAAGACAGU 1
CDS RcSBP13 1134 782 GUGCUCUCUCUCUUCUGUCA 801 20 CACGAGAGAGAGAAGACAGU 1
CDS RcSBP14 1167 809 GUGCUCUCUCUCUUCUGUCA 828 20 CACGAGAGAGAGAAGACAGU 1
CDS RcSBP15 1542 1094 GUGCUCUCUCUCUUCUGUCA 1113 20 CACGAGAGAGAGAAGACAGU 1
3’UTR RcSBP1 214 122 AUGCUCUCUCUCUUCUGUCA 141 20 CACGAGAGAGAGAAGACAGU 1
3’UTR RcSBP8 235 6 UUGCUCUCUCUCUUCUGUCA 25 20 CACGAGAGAGAGAAGACAGU 1
3’UTR RcSBP10 325 32 AUGCUCCCUCUCUUCUGUCA 51 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP5 1518 1073 GUGCUCUCUCUCUUCUGUCA 1092 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP7 1446 1160 GUGCUCUCUCUCUUCUGUCA 1179 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP8 1152 881 GUGCUCUCUCUCUUCUGUCA 900 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP9 1125 773 GUGCUCUCUCUCUUCUGUCA 792 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP10 1149 878 GUGCUCUCUCUCUUCUGUCA 897 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP11 1473 1181 GUGCUCUCUCUCUUCUGUCA 1200 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP14 1596 1151 GUGCUCUCUCUCUUCUGUCA 1170 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP15 1500 1073 GUGCUCUCUCUCUUCUGUCA 1092 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP16 1107 917 GUGCUCUCUCUCUUCUGUCA 936 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP17 1674 1229 GUGCUCUCUCUCUUCUGUCA 1248 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP19 1224 818 GUGCUCUCUCUCUUCUGUCA 837 20 CACGAGAGAGAGAAGACAGU 1
CDS HbSBP24 1197 791 GUGCUCUCUCUCUUCUGUCA 810 20 CACGAGAGAGAGAAGACAGU 1
3’UTR HbSBP1 263 156 AUGCUCUCUCUCUUCUGUCA 175 20 CACGAGAGAGAGAAGACAGU 1
3’UTR HbSBP3 266 114 AUGCUCUCUCUCUUCUGUCA 133 20 CACGAGAGAGAGAAGACAGU 1
3’UTR HbSBP6 389 18 UUGCUCUCUAUCUUCUGUCA 37 20 CACGAGAGAGAGAAGACAGU 1
3’UTR HbSBP21 2797 18 UUGCUCCCUCUCUUCUGUCA 37 20 CACGAGAGAGAGAAGACAGU 1
3’UTR HbSBP22 318 19 ACGCUCCCUCUCUUCUGUCA 38 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP1 1518 1073 GUGCUCUCUCUCUUCUGUCA 1092 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP8 1212 818 GUGCUCUCUCUCUUCUGUCA 837 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP10 1050 869 GUGCUCUCUCUCUUCUGUCA 888 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP12 1125 773 GUGCUCUCUCUCUUCUGUCA 792 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP13 1146 875 GUGCUCUCUCUCUUCUGUCA 894 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP14 1467 1178 GUGCUCUCUCUCUUCUGUCA 1197 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP15 1158 881 GUGCUCUCUCUCUUCUGUCA 900 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP16 1437 1151 GUGCUCUCUCUCUUCUGUCA 1170 20 CACGAGAGAGAGAAGACAGU 1
CDS MeSBP18 1563 1118 GUGCUCUCUCUCUUCUGUCAU 1138 21 CACGAGAGAGAGAAGACAGUU 1
3’UTR MeSBP4 211 16 AUGCUCCCUCUCUUCUGUCA 35 20 CACGAGAGAGAGAAGACAGU 1
3’UTR MeSBP17 996 18 UUGCUCCCUCUCUUCUGUCA 37 20 CACGAGAGAGAGAAGACAGU 1
3’UTR MeSBP20 218 171 GUGCUCUCUCUCGUAUGUCA 190 20 CACGAGAGAGAGAAGACAGU 1
3’UTR MeSBP21 384 122 AUGCUCUCUAUCUUCUGUCA 141 20 CACGAGAGAGAGAAGACAGU 1