Skip to main content

Table 3 Sequences of the primers used in this study

From: Comparative transcriptomic analysis of surf clams (Paphia undulate) infected with two strains of Vibrio spp. reveals the identity of key immune genes involved in host defense

Gene Id Protein Function Primer sequence
Peroxidasin Peroxidase antimicrobial defense F: TAGAAACAGCGTCCTCAACAGTTAG
R: ATCATAATCCGGTGTTAAAG
GST2 Glutathione S-transferase detoxification (oxidative stress reponse) F: TTCATCTTCACCTTCCGAACTAAAG
R: TGCCAGTGCTTGAAATAACCGAC
C1q2 Complement like factors Pathogen recognition F: TTAGCAATATCATACGGGATAG
R: AGAACAGCTGTAAATGCGATGACAT
C1qB Complement like factors Pathogen recognition F: TTAATACAAATGTTGTTGCCGACAC
R: TGTGGCCATTGAATGCTTATTGC
C1q3 Complement like factors Pathogen recognition F: GCGTTTTGGTGACAATTACATGTTC
R: TTGGTCAAATTTTATTACTAAGCC
SOCS Suppressor of cytokine signaling signal transduction F: AAACCGACGGTAACGAGAAT
R: TAAATATTTAGAATCCGAACTATCA
STAT Signal transducers and activators of transcription signal transduction F: ATCCCGTATTTCTGCTCGGC
R: GTGCGATGGCTTGTTCATGG
Perlucin Shell matrix protein/defense molecule cellular component/ immunity F: TCTACGTTTGGCTGAAGTCGGTCTA
R: GATGGCCCTTATATGTCAAT
MR2 Macrophage receptor with collagenous structure Scavenging (innate immunity) F: CAGGCAAGTGTTTTCTCGTGTTGGC
R: GTCCGGCAAGGTAGTAGCTT
BGRP Beta-glucan recognition protein Pattern recognition (innate immunity) F: AACGGCATATCTTTAGTAGCAT
R: TGAGGTTGTTGGACTAGACGCTGTC
Caspase 3 Protease Apoptosis F: CCTCCAGAACCAAGAAGCGT
R: CTGGGGTTAAGATGCCACGT
IAP inhibitor of apoptosis balance between cell proliferation and cell death by inhibiting caspase activity and facilitating immune responses F: TATGGTAAAATGGAAGACGC
R: CCACCACTGCTTCTTTGTCTAAACA
FADD Fas-Associated protein with Death Domain apoptosis F: GGTACACCAAGCTCTCGCAT
R: TGAGAGGACATGTCGAGGCT
TNF Tumor necrosis factor immunity F: TGGTTGTTCTGCATTCGCTTGTTAC
R: AATGTTCAGAAATCGGAATTGGT
Tubulin centrosomal protein Cell division; oxidative stress F: AGAGACTGGAGCTGGCAAACACGTA
R: GAGCATAGTTGTTGGCAGCGTC
Calreticulin Endoplasmic reticulum chaperon Calcium homeostasis and protein maturation; oxidative stress F: AGATATGTACGGAGAATCACCTTAC
R: TACCACTTTCTACTTTAGCGTT
Rho-J GTP-binding protein Signal transduction F: GAAGGACTGCGCGTGTTTACTTAC
R: TTGCTCCAATCTTATTCGCCAATTT
Rab-5C Ras-related protein Endocytosis F: GCCGACTGAGGTCTTAACTT
R: ACAAGCAGCCGTCGTAGTATATGAC
CYTB cytochrome b oxidase Oxidative phosphorylation F: ACAAGACTCCGGCGCATATT
R: AAAGGTCTTTCCACAGGGCAAGTCC
COX3 cytochrome c oxidase subunit 3 Oxidative phosphorylation F: CTGCAGTATTCGGAGTATAAGTGGT
R: AACGACGGAATGCGAAGTGAT
COX1 cytochrome c oxidase subunit 1 Oxidative phosphorylation F: GTTACTGCTCATGGGCTAGTG
R: ATCCTCAACCCAAACAGACCTTAAT
ND5 NADH dehydrogenase subunit 5 Oxidative phosphorylation F: GGGGGTATATGTATTACTTC
R: CTCCCAATCAAAAACACTATAATCC
ND1 NADH dehydrogenase subunit 1 Oxidative phosphorylation F: CCCCGCCCCGTATTCTACAT
R: ATAAGGGTTATTATTTGGGCAGGC