Skip to main content

Table 3 Sequences of the primers used in this study

From: Comparative transcriptomic analysis of surf clams (Paphia undulate) infected with two strains of Vibrio spp. reveals the identity of key immune genes involved in host defense

Gene IdProteinFunctionPrimer sequence
PeroxidasinPeroxidaseantimicrobial defenseF: TAGAAACAGCGTCCTCAACAGTTAG
R: ATCATAATCCGGTGTTAAAG
GST2Glutathione S-transferasedetoxification (oxidative stress reponse)F: TTCATCTTCACCTTCCGAACTAAAG
R: TGCCAGTGCTTGAAATAACCGAC
C1q2Complement like factorsPathogen recognitionF: TTAGCAATATCATACGGGATAG
R: AGAACAGCTGTAAATGCGATGACAT
C1qBComplement like factorsPathogen recognitionF: TTAATACAAATGTTGTTGCCGACAC
R: TGTGGCCATTGAATGCTTATTGC
C1q3Complement like factorsPathogen recognitionF: GCGTTTTGGTGACAATTACATGTTC
R: TTGGTCAAATTTTATTACTAAGCC
SOCSSuppressor of cytokine signalingsignal transductionF: AAACCGACGGTAACGAGAAT
R: TAAATATTTAGAATCCGAACTATCA
STATSignal transducers and activators of transcriptionsignal transductionF: ATCCCGTATTTCTGCTCGGC
R: GTGCGATGGCTTGTTCATGG
PerlucinShell matrix protein/defense moleculecellular component/ immunityF: TCTACGTTTGGCTGAAGTCGGTCTA
R: GATGGCCCTTATATGTCAAT
MR2Macrophage receptor with collagenous structureScavenging (innate immunity)F: CAGGCAAGTGTTTTCTCGTGTTGGC
R: GTCCGGCAAGGTAGTAGCTT
BGRPBeta-glucan recognition proteinPattern recognition (innate immunity)F: AACGGCATATCTTTAGTAGCAT
R: TGAGGTTGTTGGACTAGACGCTGTC
Caspase 3ProteaseApoptosisF: CCTCCAGAACCAAGAAGCGT
R: CTGGGGTTAAGATGCCACGT
IAPinhibitor of apoptosisbalance between cell proliferation and cell death by inhibiting caspase activity and facilitating immune responsesF: TATGGTAAAATGGAAGACGC
R: CCACCACTGCTTCTTTGTCTAAACA
FADDFas-Associated protein with Death DomainapoptosisF: GGTACACCAAGCTCTCGCAT
R: TGAGAGGACATGTCGAGGCT
TNFTumor necrosis factorimmunityF: TGGTTGTTCTGCATTCGCTTGTTAC
R: AATGTTCAGAAATCGGAATTGGT
Tubulincentrosomal proteinCell division; oxidative stressF: AGAGACTGGAGCTGGCAAACACGTA
R: GAGCATAGTTGTTGGCAGCGTC
CalreticulinEndoplasmic reticulum chaperonCalcium homeostasis and protein maturation; oxidative stressF: AGATATGTACGGAGAATCACCTTAC
R: TACCACTTTCTACTTTAGCGTT
Rho-JGTP-binding proteinSignal transductionF: GAAGGACTGCGCGTGTTTACTTAC
R: TTGCTCCAATCTTATTCGCCAATTT
Rab-5CRas-related proteinEndocytosisF: GCCGACTGAGGTCTTAACTT
R: ACAAGCAGCCGTCGTAGTATATGAC
CYTBcytochrome b oxidaseOxidative phosphorylationF: ACAAGACTCCGGCGCATATT
R: AAAGGTCTTTCCACAGGGCAAGTCC
COX3cytochrome c oxidase subunit 3Oxidative phosphorylationF: CTGCAGTATTCGGAGTATAAGTGGT
R: AACGACGGAATGCGAAGTGAT
COX1cytochrome c oxidase subunit 1Oxidative phosphorylationF: GTTACTGCTCATGGGCTAGTG
R: ATCCTCAACCCAAACAGACCTTAAT
ND5NADH dehydrogenase subunit 5Oxidative phosphorylationF: GGGGGTATATGTATTACTTC
R: CTCCCAATCAAAAACACTATAATCC
ND1NADH dehydrogenase subunit 1Oxidative phosphorylationF: CCCCGCCCCGTATTCTACAT
R: ATAAGGGTTATTATTTGGGCAGGC