Skip to main content

Table 3 Primer sequences of P. koraiensis

From: Transcriptomic analyses of Pinus koraiensis under different cold stresses

UnigenesForward primerReverse primer
TUBACCAGTTTGTTGATTGGTGTCCACGGCTCTCTGAACCTTGG
c67548_g2GCCTTCGTTCTGCAAGATTTGTCGCTCACAGCCTTCACAGTCCATT
c45624_g1TTACAGCACCACCGATTGGAAAGCGCTGCGATAATCCGCACACTCTT
c53894_g1AAACTCTGTGTGAGAAGCCGTGGCATCCCATTCTGGCGACAAA
c51648_g1TGTGATATACAGTCAGCGGCTGCCACAGATCCAATCGCAGTTCCA
c55399_g2AATTTCAAGTTCACTCCGCGCCTCGTCTGAGCAATATCCAACGGCT
c51762_g2CTGTATTTGATGCACTTGCCCTGTCCAATGTGACCAAGAGCCAAGGCAA
c71292_g4ACCAATCCATCGCCAACAGCAAAGCACAACCGAAGGATACAACACCCA
c72543_g1AACACCTGTCACTCCAGAATGCTCCTATCGACCATGCTGATTTCACCCG
c68652_g2TAATTTGGTTGCCGAAGCCTGGCAAAGCTCTGCCCTGTTTCCACAT
c69240_g2AAGATGTAGTGGTCAGCGAGTGCGCAAGAGATCGAAACGCTCAAGACA
c69290_g1ACCTCCGTCTCCGATAATTGAACCGGAGGCTTAAAGACCAGGAGAGGA
c70248_g1GATCGAGTTGTGTGTCTGCTTGTGCCTCTCATGGCTATCTGTTCTCCG