Skip to main content

Table 6 Optimized accD and ycf1 barcode primers for the family Asteraceae

From: Comparative chloroplast genome analysis of Artemisia (Asteraceae) in East Asia: insights into evolutionary divergence and phylogenomic implications

BarcodePrimerSequence (5′ to 3′)
accD-1 kForwardConsensus at 95% thresholdaCGATGTTATTTAAGAMGGAGTTCG
 accD-Asteraceae-FbCGATGTTATTTAAGAAGGAGTTCG
ReverseConsensus at 95% thresholdaCAAACGGGTAATTTTCTCCCC
 accD-Asteraceae-RbCAAACGGGTAATTTTCTCCCC
Expected amplicon size (bp)928–1079
ycf1bForwardConsensus at 95% thresholddRMTCGACGAAAATCYGGTTCTTCYAAAT
 ycf1b-Asteraceae-FcGCTCGACGAAAATCCGGTTCTTCCAAAT
 ycf1bFeTCTCGACGAAAATCAGATTGTTGTGAAT
ReverseConsensus at 95% thresholddWTACATGYSAAAGTGATGGAAAA
 ycf1b-Asteraceae-RcATACATGCCAAAGTGATGGAAAA
 ycf1bReATACATGTCAAAGTGATGGAAAA
Expected amplicon size (bp)874
  1. aConsensus at 95% threshold across 212 accD sequences from the family Asteraceae
  2. b, cOptimized primers for the family Asteraceae
  3. dConsensus at 95% threshold across 211 ycf1 sequences from the family Asteraceae
  4. eUniversal barcode primer set designed for angiosperm [30]