Skip to main content

Table 5 The designed primers for amplification and sequencing of the chosen regions

From: A comparison of BeadChip and WGS genotyping outputs using partial validation by sanger sequencing

Chromosome Orientation Name Sequence 5′3’ Length Tm GC Start End Amplifying length N mismatches Mismatch type
1 F chr1_reg1_F AAGCCCTCGGAGTAGCTTTC 20 59.46 55 109711755 109711774 397 3 3 SNV
1 R chr1_reg1_R GGCTGGAATCAATAAGCCCC 20 58.67 55 109712151 109712132 397 3 3 SNV
1 F chr1_reg2_F TGATGGACAGGATGGAGTTGTAG 23 59.55 47.83 109759300 109759322 85 1 1 INDEL
1 R chr1_reg2_R GAGCTGGACTCTTACCGCCTA 21 61.02 57.14 109759384 109759364 85 1 1 INDEL
2 F chr2_reg1_F GTGGTCACGGACATGCAGA 19 60.01 57.89 85663428 85663446 344 1 1 INDEL
2 R chr2_reg1_R CTGAGCGCTACTCCGTCATC 20 60.32 60.00 85663771 85663752 344 1 1 INDEL
2 F chr2_reg2_F CTCTGGACAGAGAGTATTTGGTTG 24 58.83 45.83 233671510 233671533 370 1 1 INDEL
2 R chr2_reg2_R AGGTGGGAGAAATACCAGCAC 21 59.72 52.38 233671879 233671859 370 1 1 INDEL
6 F chr6_F TTTAAGAAGGCAGGGGATTGCT 22 59.96 45.45 160246431 160246452 490 3 3 SNV
6 R chr6_R GCAACTTAAGCCTTCACCAGT 21 58.77 47.62 160246920 160246900 490 3 3 SNV
10 F chr10_F CCTGGAGACTTGCCTTGACC 20 60.32 60 101010511 101010530 233 1 1 INDEL
10 R chr10_R CCTCTACAAGACGTGCCAGT 20 59.40 55 101010743 101010724 233 1 1 INDEL
13 F chr13_F AAGCTCTTGATGCGGTGGTT 20 60.25 50 49792463 49792482 330 1 1 INDEL
13 R chr13_R CACGTATAGCCCGGCGAA 18 59.59 61.11 49792792 49792775 330 1 1 INDEL
22 F chr22_F CGAGGGCCCCATATAGGAGA 20 59.96 60 37973603 37973622 408 1 1 INDEL
22 R chr22_R GAGTTGGACCAGTACCTGCC 20 60.04 60 37974010 37973991 408 1 1 INDEL