Skip to main content

Table 3 Oligonucleotide primers used in real-time PCR assays in this study

From: Third-generation sequencing found LncRNA associated with heat shock protein response to heat stress in Populus qiongdaoensis seedlings

Gene Primer pairs
miR399f F:GTGCCAAAGGAGAATTGCCCTGAA
miR530a F:GTGCATTTGCACCTGCACCTTAAA
miR482a.1 F:GGCCTACTCCTCCCATTCCAAAA
miR1444d F:GCGAACGTTGACCGAATGTGAAAA
18 s rRNA F:CGGCTACCACATCCAAGGAA
R:GCTGGAATTACCGCGGCT
β-actin F:AGTGCTTCTAAGTTCCGACAG
R:GGAGGACCATTACAGTTACGC
HSP18.1–1 F:TAAATACTCGCTCATTCCTCA
R:AAGACATCGGTAGATTCACCA
HSP18.1–2 F:GGTCTTGACAGTGACTGCCTAA
R:ACTCCCTACAACACTCCACAA
HSP18.1–4 F:CTCAGCTAGCTTTCACGTCGC
R:CCAGTCTATGCGTGTGCTGGC
HSP18.1–5 F:CTTGAGGAGGTTCAGATTGCC
R:ATCCCATTCCGCGAGTCTTTC
HSP18.2–2 F:TGATTCTTGTCCTTCCCTTTC
R:ATGTTTCTTTGGCGACCTCTG
HSP18.2–3 F:GGTCTTGACAGTGACTGTGCCT
R:TCATTGAAATGCGCATCTTCTATC
lncHSP18.2 F:GTCGCCTAACACTTGCTTT
R:CATCACTTTATCCCATTCC