Skip to main content

Table 2 Oligonucleotides used in this study. Relevant restriction sites are underlined

From: Conditionally essential genes for survival during starvation in Enterococcus faecium E745

Name Sequence (5′- 3′)
oVDM2001 AAACACGTTCTTTCCAAACCGTTTCATCCTTTGAG
oVDM2002 AAAACTCAAAGGATGAAACGGTTTGGAAAGAACGT
oVDM2003 CAAACAACGGCATTAACGGAGATTACCAT
oVDM2004 GTGTTTGATAAAAAACTTTGTCTACATGAC
oVDM2005 CTGCATATGCTGTTTTAGGCG
oVDM2006 GTGTAATTCTGTCAGAGAGC
oVDM2007 AAAAAAAACCCGGGCAATTGGGGCTATCCATCGGGAAATGAATGCC
oVDM2008 AAAAAAAACTCGAGTTATGACGACGGACTTCTCGC
oVDM2009 GAGGGAATTCTACCGTTCGTATAGCATACATTATACGAAGTTATGATAAACCCAGCGAACCATTTGAGG
oVDM2010 CTCCGAATTCTACCGTTCGTATAATGTATGCTATACGAAGTTATTCAATCTTTATAAGTCCTTTTATAA
oVDM2011 GGAGGCAGATTGCCTTGAAT
oVDM2012 TCCAATAATTCGGCTCTCT
oVDM2013 GACTCGTTTATGTTTTGTTCCGTC
oVDM2014 GTATTTTCCAAGATCGTTCG
oVDM2015 AAAAAAGTCGACACAAGAAAACGGTTCTGTTTCTGCGAGC
oVDM2016 AAAAAAACCCGGGTTAAGCTTTGGTGTGGTCTTTAGCT
oVDM2017 CGGAGCCACGGCGGCCGAA
oVDM2018 CTGCGCGTAATCTGCTGCTTCGA