Skip to main content

Table 1 Primers for the amplification of putative Y chromosome markers for Bassiana duperreyi

From: Identification of Y chromosome markers in the eastern three-lined skink (Bassiana duperreyi) using in silico whole genome subtraction

Primer Name Sequence (5′–3′) Product size (bp)
Forward Reverse
bdM27_87_X6_628 TCTGAGGACATTGCAGGAACAA GGCCTAATGAGACCTAGCAGTC 269
bdM27_10_X7_874 AAGATGGGAACTGCACTGGTAG CAATATCCCCTGATGCAGCTCT 418
bdM27_74_X11_649 GAGGTCTGACAGAACCCTCTTG TTTTGGTCCTGGAACAAGGTGA 286
bdM27_79_X5_643 TGTGAGACAATAGTGACCAGGC TGCTCAGGTCTAGGGATGTGTA 294
bdM27_82_X5_636 TCTTTCTCTTTGCCCCAACCTT ACTCTTGAATGTCGCAGTAGCA 380
bdM27_69_X9_658 TCAATGGACCTTGCATCATGGA CCTTGGATTACTGCACTGACCT 390
bdM27_23_X5_798 TGTTCTCCGTACAATCACTGCA TGACTTTTTGGCCGTGTAATGG 439