Skip to main content

Table 1 Primers used in qRT-PCR to validate RNA-seq data

From: Transcriptomic analysis of gene expression of Verticillium dahliae upon treatment of the cotton root exudates

Accession no.Gene descriptionPrimiers
VDAG_01193high-affinity nicotinic acid transporter5' GTGCCATCTCCGGCTTCATC 3'
VDAG_01866xylosidase/arabinosidase5' CAGCTCCGTGCTCAATGTGCC 3'
VDAG_03038periplasmic trehalase5' GGCAACAACCTCACTCGC 3'
VDAG_03526alpha-glucuronidase5' GTGACGGCGGACAACTCTAC 3'
VDAG_04513hexose transporter protein5' TCAACATTGCCATCCAGGTC 3'
VDAG_07563sugar transporter STL15' AGTGCCCGTCGTCTACTTCTT 3'
VDAG_08286alpha-glucosides permease MPH2/35' GTATCGGCCAGACCAACCA 3'