Skip to main content

Table 1 Primers for RT-PCR or qRT-PCR

From: Transcriptome-wide map of m6A circRNAs identified in a rat model of hypoxia mediated pulmonary hypertension

NameSequenceProduct size(bp)
linear Xpo6Sense: 5’CTGTGTTTTGGGTCAGGAGC3’
Antisense: 5’ATCGAGTTCCTCTAGCCTGC3’
199
linear Tmtc3Sense: 5’ACTCTGCTGTGATTGGACCA3’
Antisense:5’AGAAGAGGTTTGATGCGGGA3’
203
circXpo6Sense: 5’TCTGGGAGACAAGGAAGCAG3’
Antisense: 5’CAGGATGGGGATGGGCTG3’
101
circTmtc3Sense: 5’TACCCATGTTCAGCCAGGTT3’
Antisense:5’GAAGCCAAGCATTCACAGGA3’
100