Skip to main content

Table 5 RT-qPCR primers for validation experiment

From: Transcriptome sequencing and whole genome expression profiling of hexaploid sweetpotato under salt stress

Unigene code Direction Sequence (5'->3') Length
g299 Forward TTTTCGTAATCCTGGCGGCG 20
Reverse ACCGTGTCGGAGAAGTTGGT 20
g2083 Forward CCGCCCGAGAGGAAGTACAG 20
Reverse GGGCCAGACTCGTCGTACTC 20
g2359 Forward GGAGGCGTTTGCTGCTTACC 20
Reverse TGCCCTCGACGTTGAACCTT 20
g3153 Forward TTCGACGCCTACTTCGGGAC 20
Reverse GTCCGGCCCGAGAATTACCA 20
g6075 Forward TCTAGCAATGGTGCTGCGGA 20
Reverse AGCCCTACTGCTCCAACTACG 21
g6453 Forward TATGGTGTCGGTACGGCGTC 20
Reverse TGACTCAGTTCTAGCGGCCC 20