Skip to main content

Table 2 Primers sequences of JrFADs and JrACT2 for qRT-PCR

From: Identification and analysis of the FAD gene family in walnuts (Juglans regia L.) based on transcriptome data

NameSequence (5′–3′)
JrACT2F: TCCACCATGTTCCCTGGTAT;R: ACCTCCCAATCCAGACACTG
JrSLD-1F: ACTTGGTTTGGGAGGCTGTC;R: TCGTCCTAACAACCCCAAGC
JrADS3F: TTCCTTGTGTGGGGAATGGG;R: AAATGCAAGCAATGCCACCC
JrSAD-2F: TTTTTCCCCTTCTCAACCTCCAA;R: TGGTGTAAAAGGCTTCTTTGGATTG
JrSAD6F: AAGCTGGAGGATTTGACGGG;R: CCAGCTAAACTTAACGCCGC
JrFAD3-1F: ATCCACCATGATATCGGCACC;R: GAAGGGGAATTGGCCCAGA