Skip to main content

Table 6 Primers designed for RT-qPCR of DEGs

From: Transcriptomic analysis of sea cucumber (Holothuria leucospilota) coelomocytes revealed the echinoderm cytokine response during immune challenge

Gene IDP-valuesForward primer sequences (5′-3′)Reverse primer sequences (5′-3′)
Differentially expressed genes(DEGs)
CL3876.Contig4_Mix0TCACGGCATTGAGAACGGCGGTGTCTGAACTTTGGGT
Unigene38924_Mix0CAGACAAAAGCCTCAGAAATGAAGAACCCAGAGCTGGAAAG
Unigene36248_Mix0ATACGAAAAGCGGCAAACATCCATCTCAGACCCCAACTC
Unigene1474_Mix0TCCATCTCAGACCCCAACTCTTTCCATTGGGAGGTAAGC
Unigene6464_Mix0TCACTGCGGCATTGATTCGGTGCCCTTCCGTCAATT
Unigene36250_Mix0GTGCAAAGAAGGGAAGGCTCTGGTGATTTATGTTGTGGG
Unigene42438_Mix0ACTCATGTGGATGGCACTAGCGGAAGAAGGGACAGAATAAACC
CL3998.Contig1_Mix1.89E-260AAGGATTATGGACGGGACACTTCTCAAACCACCAGAGGG
Unigene1910_Mix0GTCAAACCAATAACAGCGAAAGTGGACCAGACCAGGCAAA
Unigene27584_Mix0CGTGCTTGCCGAGTTTGTGCAGGCTATTGCTGTTGTTAA
CL657.Contig6_Mix0AAGCAAGATAGACACTGTGGTTCGATTGATGCCCCGTAAGC
CL3619.Contig1_Mix0AGGGTAACAGGTTGGGTGAAGCAGTAGTTGGAGCCATTGAA
Unigene11374_Mix0TGCGTTTGTTGACTTTTGCTGAAATGGTTCCGATTCTCA
Unigene2830_Mix0TTTGCTGGAGTATTGTGGTTCTGGGCTGTAGGGGCTTTA
Unigene6841_Mix2.03E-139ACCCCAGATGACCTTTGACCGTTAACACAATTTCTCCAGTTAGGA
Unigene2638_Mix1.05E-297AGTTGATATTCACCAGCCTTGCCCACTTTCCATGAAACCGTAA
Unigene1366_Mix2.56E-93GGAGGTCAATGGTCATTTGGACCCCTGGTGACCCTACAT
Unigene1518_Mix7.31E-233AAACACGGTATCTCCAGAATGAAATGACCTTTGACCTCCACC
Unigene16828_Mix0TTCAAAAGCAGTGCCAACGCATTATCATCATCTTGCCGAAC
Unigene3853_Mix2.50E-62CCACTTGGACAGCAGTGAAGTGATGACCTGGTTTGAGAAGAC
Cytokine genes
CCL3-X30.000883536CGCAAAGGATTGTGATGGTACAGGAAGAGGCTATACAGACG
CLL100.013152297CTTACTGGGTTGGTAGTTTTGACGTGCGTTCTTGCCATTCTC
CLL7A0.00023473TCTTGCTTCTCACCCGATTTCCGTAGGGGACACCTCTTT
CLL9-X3a5.57E-09TGGTGGAATAGTGGAGGGTGGACTGGTTGGTTGAGGCTGT
CLL9-X3b0.003436624AACAGACGGACAGTCATACAGCTGGTTGAGCCCTTGATAGTG
CLL9-X3c0.005767319CATTCCAGTTGGTGATGGCTGATTTCCTCACCGCATTT
CLL9-X3d2.23E-07CAGAAAGCCTGGGTAAAGCGACCTGGACCAAACCTCATT
EDRF1a0.101229003TTACAAGACTATCCTCCCCTCAGCGATGCGATACTGATAAAGG
EDRF1b0.311031428ATGGCTTTTGAGGATGGTGGCTGCTGTATCTCAGGAGGAAA
EDRF1c0.000470648ACCAACCACCATCCAACTGTTCTCCTGATCCACCCCTAA
EDRF1d0.001415506TCCCTTTATTGTTCCTGTGGTGTCTCCGCTTTCCTGTAGTA
IL-171.94E-07AGGCTGGCTCGCTTCTTACGCTATCGCTCATTGGAC
IL-17-25.40E-08GTTGAGGCATTCACATTTCGAACTTTCGGCAGTCCTTACAG
IL-17B1.36E-05TACCATAGGAAGGGGATCTGTAGACTTGCCCGACGATTT
IL-17C/E3.56E-23AGGCACTCTTCTGCATTCTCCGCTACTGAACGCTTGTTGACG
TPO-I-7A21.90E-07CGGCGGCATACAACAGAACATTGGGCATCCAGAACA
TPO-I-7A30.003209029GGTCCAAAGAAAGGCATCAGGCTTGAAAGTAAGAAACCGT
TPO-I-7B15.20E-08GATTCAGCCTTCATTTTGGAGCTTAGTATCTTTGGGTCTGTCTA
TPO-I-7B20.000343861GATTCAGCCTTCATTTTGGAGCTTAGTATCTTTGGGTCTGTCTA
TPO-I-7B30.7252968TGGTCCAAGTGGTCTCCCTCTGGTCCTCTGGTAAACAGTCAT
TSP-40.086692271CAGGAGTCTTATTTGGTATCTATGCCAATGTGGCGATGGTGTTC