Skip to main content

Table 2 Designed primers for the β- and γ-CA genes

From: Assessment of databases to determine the validity of β- and γ-carbonic anhydrase sequences from vertebrates

CA familyVertebrate speciesPrimer pairsProduct length (bp)
γ-CAFelis catus (cat)P1Forward: 5′- AGATAACTACTTCACATCTGACA −3’1089
Reverse: 3′- ATACAGGGCTGGGTGCCT −5’
P2Forward: 5′- GGTGATTGGCGACTACGTGA − 3’625
Reverse: 3′- CTCAGTCGGTTAGGTGGCTG − 5’
P3Forward: 5′- GCGCGTGAAGAACAACTACC − 3’217
Reverse: 3′- GTGTTCAGTTGCGTCATCGG − 5’
P4Forward: 5′- AAGCGGCAACCTCTACATCG −3’341
Reverse: 3′- CGTGAGGTAGGCAGTAGACG −5’
β-CAMus musculus (Mouse)P5Forward: 5′- TGATAATGCCGATGGTCGTG −3’1023
Reverse: 3′- AGTAGCCATGGCCTTGCGAT −5’
P6Forward: 5′- TGGATTTTCCGGCACCGTTA −3’441
Reverse: 3′- CGGGTCTTCCTTGCTGATGT −5’
P7Forward: 5′- ACATCAGCAAGGAAGACCCG −3’391
Reverse: 3′- CACAATACGTCAAGGCGCTG −5’
P8Forward: 5′- GCTGCACATCCGTGATCTCT −3’191
Reverse: 3′- GGATCCCATACACCCAACCG −5’