Assessment of databases to determine the validity of β- and γ-carbonic anhydrase sequences from vertebrates

BMC Genomics

Table 2 Designed primers for the β- and γ-CA genes

CA family	Vertebrate species	Primer pairs		Product length (bp)
γ-CA	Felis catus (cat)	P1	Forward: 5′- AGATAACTACTTCACATCTGACA −3’	1089
		P1	Reverse: 3′- ATACAGGGCTGGGTGCCT −5’	1089
		P2	Forward: 5′- GGTGATTGGCGACTACGTGA − 3’	625
		P2	Reverse: 3′- CTCAGTCGGTTAGGTGGCTG − 5’	625
		P3	Forward: 5′- GCGCGTGAAGAACAACTACC − 3’	217
		P3	Reverse: 3′- GTGTTCAGTTGCGTCATCGG − 5’	217
		P4	Forward: 5′- AAGCGGCAACCTCTACATCG −3’	341
		P4	Reverse: 3′- CGTGAGGTAGGCAGTAGACG −5’	341
β-CA	Mus musculus (Mouse)	P5	Forward: 5′- TGATAATGCCGATGGTCGTG −3’	1023
		P5	Reverse: 3′- AGTAGCCATGGCCTTGCGAT −5’	1023
		P6	Forward: 5′- TGGATTTTCCGGCACCGTTA −3’	441
		P6	Reverse: 3′- CGGGTCTTCCTTGCTGATGT −5’	441
		P7	Forward: 5′- ACATCAGCAAGGAAGACCCG −3’	391
		P7	Reverse: 3′- CACAATACGTCAAGGCGCTG −5’	391
		P8	Forward: 5′- GCTGCACATCCGTGATCTCT −3’	191
		P8	Reverse: 3′- GGATCCCATACACCCAACCG −5’	191

ISSN: 1471-2164