Skip to main content

Table 4 Primer sequences for qRT-PCR test

From: Multipathway synergy promotes testicular transition from growth to spermatogenesis in early-puberty goats

Gene Forward primer Reverse primer
ACTBa GTCACCAACTGGGACGACAT CATCTTCTCACGGTTGGCCT
FATE1 GCATGAGGTCCCAGTACGAG GTAGCGCAGACGCTCAGTAA
KIAA1210 TATGAAGGCACTGCTTGCCA ACAGAACCCTCCAAACCTGC
S100B ATATTCCGGGAGGGAAGGTG GGTAACCATGGCAACGAAAGC
AMH CATACCAGGCCAACAACTGC CTGATGAGGAGCTTGCCTGT
FGFR1 AAATGCCCTTCCAGTGGGAC AGGTGGCATAACGGACCTTG
DKKL1 AGGTGGTGGCATCCATTGAG ATGATCCAGAAGGCCACTCG
PHKG2 AAGACGTCATTGGCAGAGGAG GCGACCTGGCGAAGGATATG
CABYR GCAGGACAACCACCACCATA GGTCTTCTTGCTGTCGTCCA
MORN2 TGGTTTCGGAAGACTTGAGC ACTTTGCCCCAGTTGGGAAT
BCAM GACTACGTGTGCGTGGTGAA GCTGCAAGTGGCTATCTCCT
AGRN GTGAAGAATGGGGAAGCCGA GTTCGCACACACTGCCATAC
  1. aGene ACTB was used as the reference gene