Skip to main content

Table 1 Conserved motifs present in pearl millet PgNACs. Conserved motifs were identified using the online tool MEME with the default parameters

From: Comprehensive analysis of NAC transcription factor family uncovers drought and salinity stress response in pearl millet (Pennisetum glaucum)

No. Motif Sites E-value Width GO annotation
1. TCCTCCTGGATTTAGATTTCATCCTACTGATGAWGAACTTRTTRNTYATT 130 5.4e-1077 50 BP: Multicellular organism development
2. AGAMCTAATAGAGCTACTGVWDCTGGATATTGGAAGGCTACTGGAAMKGA 74 1.7e-852 50 CC: chloroplastMF: RNA binding
3. TTGGAATGAAGAAGACTCTTGTTTTTTATAGAGGAAGAGCTCCTAAGGGA 77 7.1e-802 50 MF: oxygen binding
4. TGTTATTGCTGAAGTTGATATTTATAAGTTTGATCCTTGGGATCTTCCTG 149 3.9e-805 50  
5. AAGACTGATTGGATTATGCATGAATATAGACTTGAAGATGCTGATGATGC 128 6.6e-773 50  
6. AGGAATGGTATTTTTTTTCTCCTAGAGATAGAAAGTATCCTAATGGAGCT 87 1.6e-640 50  
7. CTGCTGCTCCTGCTCCTGCTCCTATTGTTATTGCTCAAGCTGCTGCTCCT 145 1.2e-566 50  
8. CTGCTGCTGGAGGAGGAGAAGGATCTTCTTCTGAAGCTGCTGCTGCTGCT 145 5.8e-452 50 CC: mitochondrionCC: chloroplast thylakoid membraneCC: anchored to membrane
9. TAAGGAAGATTGGGTTCTTTGTAGAGTTTTTTATAAGTCTAGAGCTACTA 134 3.8e-395 50  
10. TACTCTTACTCATGATTCTGTTATGCCTTCTACTGCTGCTCAAGTTTCTG 125 2.6e-338 50 MF: RNA bindingCC: chloroplast thylakoid membraneMF: transcription factor activityBP: protein transportMF: ATP binding
11. GCTCCTCCTCCTCCTCCTCCT 143 7.5e-212 21  
12. TTCCTAAGGTTGAACCTCAAGCTGATGATGGAGGAAATTCTCTTGCTGCT 125 1.3e-259 50  
13. CTTCTTGCTGATACTACTTCTGGAGCTTTTCAATATTCTTCTCTTCTTT 125 1.6e-172 49 CC: plasma membrane
14. TTAAGCTTGCTGGAGAAGCTCTTCCTGCTGCTGCTGGATCT 121 3.6e-121 41  
15. AGAAATTTCTTCTTCTTCTGATTATCTTAAGCTTCCTCCTGAACCTGCTG 78 6.3e-104 50  
16. TCTTGCTCCTAAGGCTGCTGATGCTGGA 145 1.4e-093 28 CC: chloroplast
17. GCTGATCCTTCTTCTGCTCCTGTTAAGGCTAAGAGACAAC 53 2.2e-067 40