Table 2 Targets of novel tasiRNAs in Oryza sativa
From: Degradome sequencing-based identification of phasiRNAs biogenesis pathways in Oryza sativa
TaisRNA ID | tasiRNA sequence | Targets | Target annotation | miRU start-ending | taisRNA mediated cutsites |
|---|---|---|---|---|---|
LOC_Os02g18750.1(189)21 3’D26 (+) | UGUGCCACGUCAACACCACCA | LOC_Os03g40260.1 | Regulator of chromosome condensation domain containing protein | 1676–1696 | 1687 |
LOC_Os02g18750.1(192)21 3’D25 (+) | GCGCCACUGCCGUCGACGUGU | LOC_Os02g39380.1 | OsCML17 - Calmodulin-related calcium sensor protein | 343–363 | 354 |
LOC_Os02g18750.1(204)21 3’D13 (+) | UCGACUUCGCCGCCUCGGCGC | LOC_Os02g39090.1 | expressed protein | 802–823 | 814 |
LOC_Os05g43650.1(1540)21 3’D2(+) | UCAAUAUGAAUGUGGAAAAUG | LOC_Os01g15520.1 | expressed protein | 1248–1268 | 1259 |
LOC_Os01g34620.8 | OsGrx_S15.1 - glutaredoxin subgroup II | 500–520 | 511 | ||
LOC_Os03g50070.1 | DUF1295 domain containing protein | 1195–1215 | 1206 | ||
LOC_Os04g38450.1 | gamma-glutamyltranspeptidase 1 precursor | 2137–2157 | 2148 | ||
LOC_Os04g49160.1 | zinc finger, C3HC4 type domain containing protein | 1093–1113 | 1104 | ||
LOC_Os05g03574.1 | expressed protein | 648–668 | 659 | ||
LOC_Os06g23274.1 | zinc finger, C3HC4 type, domain containing protein | 4632–4652 | 4643 | ||
LOC_Os06g47850.1 | zinc finger family protein | 97–117 | 108 | ||
LOC_Os08g19114.1 | expressed protein | 2050–2070 | 2061 | ||
LOC_Os08g40440.1 | dihydroflavonol-4-reductase | 1315–1335 | 1326 | ||
LOC_Os09g12230.1 | ubiquitin-conjugating enzyme | 1021–1041 | 1032 | ||
LOC_Os09g27500.1 | cytochrome P450 | 1714–1734 | 1725 | ||
LOC_Os11g41860.1 | OsFBX429 - F-box domain containing protein | 1030–1050 | 1041 | ||
LOC_Os11g41860.2 | OsFBX429 - F-box domain containing protein | 973–993 | 984 | ||
LOC_Os12g12950.1 | expressed protein | 1071–1091 | 1082 | ||
LOC_Os05g43650.1(1540)21 3’D2(−) | UUUUCCACAUUCAUAUUGAUG | LOC_Os02g45650.1 | peptidase | 1760–1780 | 1771 |
LOC_Os05g43650.1(1542)21 3’D1(+) | AAUGAAUCUAGACAUAUAUAU | LOC_Os02g05810.1 | expressed protein | 1330–1350 | 1341 |
LOC_Os02g05810.2 | expressed protein | 1324–1344 | 1335 | ||
LOC_Os02g52900.2 | glutaredoxin 2 | 2034–2054 | 2045 | ||
LOC_Os02g53000.2 | lysM domain-containing GPI-anchored protein precursor | 1340–1360 | 1351 | ||
LOC_Os04g44590.1 | expressed protein | 651–671 | 662 | ||
LOC_Os04g44590.5 | expressed protein | 445–465 | 456 | ||
LOC_Os05g41190.1 | expressed protein | 1026–1046 | 1037 | ||
LOC_Os05g41190.2 | expressed protein | 1082–1102 | 1093 | ||
LOC_Os05g51140.1 | expressed protein | 929–949 | 940 | ||
LOC_Os05g51140.2 | expressed protein | 1586–1606 | 1597 | ||
LOC_Os09g33930.1 | farnesyltransferase/geranylgeranyltransferase type-1 subunitalph | 1457–1477 | 1468 | ||
LOC_Os09g33930.2 | farnesyltransferase/geranylgeranyltransferase type-1 subunitalph | 1454–1474 | 1465 | ||
LOC_Os09g33930.3 | farnesyltransferase/geranylgeranyltransferase type-1 subunitalph | 1740–1760 | 1751 | ||
LOC_Os09g33930.4 | farnesyltransferase/geranylgeranyltransferase type-1 subunitalph | 1453–1473 | 1464 | ||
LOC_Os09g33930.5 | farnesyltransferase/geranylgeranyltransferase type-1 subunitalph | 1375–1395 | 1386 | ||
LOC_Os12g37510.1 | UDP-glucoronosyl and UDP-glucosyltransferase domain containing | 1584–1604 | 1595 | ||
LOC_Os05g43650.1(1543)21 3’D2(−) | GCAUUUUCCACAUUCAUAUUG | LOC_Os02g48390.1 | phosphoribosyltransferase | 1758–1778 | 1769 |
LOC_Os05g43650.1(1543)21 3’D3(−) | UUCACAAUGUAAGUCAUUUUA | LOC_Os04g39600.1 | fasciclin domain containing protein | 1020–1040 | 1031 |
LOC_Os07g01130.1 | pentatricopeptide containing protein | 4240–4260 | 4251 | ||
LOC_Os05g43650.1(1543)21 3’D1(+) | AUGAAUCUAGACAUAUAUAUC | LOC_Os12g40920.1 | bZIP transcription factor domain containing protein | 1312–1332 | 1323 |
LOC_Os06g30680.1(62)21 3′ D2(+) | CAUGGACAACUUCCUGCACAG | LOC_Os05g46580.1 | polyprenylsynthetase | 1365–1385 | 1376 |
LOC_Os12g42380.1(414)21 5’D7(+) | UUUCUUCCAAGAGAGAGUAAG | LOC_Os07g47700.1 | NAD dependent epimerase/dehydratase family domain containing protein | 1753–1773 | 1764 |