Skip to main content

Table 4 The oligomeric single stranded DNA sequence of shRNAs

From: Study on the transcriptome for breast muscle of chickens and the function of key gene RAC2 on fibroblasts proliferation

Name The oligomeric single-stranded DNA sequences
shRAC2–1 GGATCCGCTATACCACTAATGCCTTCCTTCAAGAGAGGAAGGCATTAGTGGTATAGCTTTTTT
shRAC2–2 GGATCCGGATCTTCGTGATGACAAAGATTCAAGAGATCTTTGTCATCACGAAGATCCTTTTTT
shRAC2–3 GGATCCGCTTTCTCCTATTACATATCCTTCAAGAGAGGATATGTAATAGGAGAAAGCTTTTTT
shRAC2–4 GGATCCGCAGTGAGTGAGACCCAATAATTCAAGAGATTATTGGGTCTCACTCACTGCTTTTTT
  1. Note: The underlines are the interference sequences and their complementary sequences