Skip to main content

Table 2 The primer information of qRT-PCR

From: Immune profiles of male giant panda (Ailuropoda melanoleuca) during the breeding season

Gene Primer (5′ → 3′)
MFAP1-F AACCGCCCATTCAGTCTACG
MFAP1-R ATGCCGGGCCAATCTTTCTT
HSP90AA1-F TGCGAGGAGCTAATCCCTGA
HSP90AA1-R TCGTGAATTCCCAGCTTGATGT
PSMD7-F TGTTGTTGGTGTGCTTTTGGG
PSMD7-R CATCTTCATCAAAAGGGACTGCAAA
S100A9-F CCAGCTCAGGGTTACCACAC
S100A9-R CCATCTTCCTGCGTTCCAAGT
SOD1-F AGAAGGAAGGTGGGCCTGTT
SOD1-R TGCACTGGTACAGCCTTGTGT
CD3D -F AGGCTCTCCAAGGCTGCAAA
CD3D -R TCTTCCGAGGCCAGTTTTCAC
RPL9-F TGCTGCGTCTACTGCGAGAATG
RPL9-R ATGTGATTGAAGTCCCTTCGCA
KLRD1-F ATCACAGAACTCCAGAAAGGCTC
KLRD1-R GACAGTGGAGCCATCTTCCC
IGIP -F GTGTGAACGTTTGTGGCTGG
IGIP -R CCCCCAAATTGGTCCACAGT
SEC61B -F GGCACTAATGTGGGCTCGTC
SEC61B -R TACTGGAACAGGGCCAACCTTGA
PHF5A -F GCCATCGGAAGACTGTGTGAAA
PHF5A -R CGCCCCTGGTAAGAGCCATA
VMA21-F AGCCGCCCGACTTCAGAAATGA
VMA21-R CCACCGCAACAATAGCAGCA
GAPDH -F GGTATGACAACGAATTTGGCTACA
GAPDH -R GATGGAAACAGTGGAGGTCAGGA