Skip to main content

Table 3 Primers for qRT-PCR validation of candidate miRNAs and mRNAs

From: Differential microRNAs expression profiles in liver from three different lifestyle modification mice models

  Gene Primer
miRNA mmu-miR-141-3p CGCTAACACTGTCTGGTAAAGATGG
  mmu-miR-200b-5p CATCTTACTGGGCAGCATTGGA
  mmu-miR-34a-5p TGGCAGTGTCTTAGCTGGTTG
  mmu-miR-380-5p CGATGGTTGACCATAGAACATGCG
  mmu-miR-409-3p CCGAATGTTGCTCGGTGAACC
  mmu-miR-455-3p GCAGTCCACGGGCATATACAC
  mmu-miR-487b-3p CAATCGTACAGGGTCATCCACTT
  mmu-miR-683 CCTGCTGTAAGCTGTGTCCTC
  mmu-miR-802-5p GGCCTCAGTAACAAAGATTCATCCTT
  mmu-miR-96-5p GTTTGGCACTAGCACATTTTTGCT
  mmu-miR-99a-5p CAACCCGTAGATCCGATCTTGTG
  mmu-let7e-5p CGCTGAGGTAGGAGGTTGTATAGT
mRNA Atp6v0a1 F: CCGAGGACGAAGTGTTTGACT
R: ATCAGCAGGATAGCCACGGT
  Elovl2 F: CCTGCTCTCGATATGGCTGG
R: AAGAAGTGTGATTGCGAGGTTAT
  Lamp2 F: TGTATTTGGCTAATGGCTCAGC
R: TATGGGCACAAGGAAGTTGTC
  Wdr18 F: TGGTGTGGGAGCTTCATTCG
R: CCCAGGCGCAGATGTAGTTC
  Hmbs F: ATGAGGGTGATTCGAGTGGG
R: TTGTCTCCCGTGGTGGACATA