Skip to main content

Table 2 List of miRNAs that are negatively correlated with AANAT expression in the sheep pineal gland

From: Expression characteristics of pineal miRNAs at ovine different reproductive stages and the identification of miRNAs targeting the AANAT gene

miRNA ID Conserved ID Mature sequence Correlation coefficient R Predicted target relationships
miR-89 hsa-miR-214-3p acagcaggcacagacaggcag −0.424 Yes
miR-69 mmu-miR-326-3p ucucugggccugugucuuaggcu −0.420 Yes
oar-miR-25 hsa-miR-25-3p cauugcacuugucucggucuga −0.378 Yes
hsa-miR-28-5p hsa-miR-28-5p aaggagcucacagucuauuga −0.297 Yes
oar-miR-370-5p hsa-miR-370-3p gccugcugggguggaaccuggu −0.289 Yes
miR-58 mmu-miR-744-5p ugcggggcuagggcuaacagca −0.289 Yes
miR-201 hsa-miR-3156-3p uucccacucccucuguccgccu −0.960 No
miR-919 gaggguuuggguuuggucguggga −0.955 No
miR-922 uccccccacgcccgggcca −0.955 No
miR-925 gggcaggguugggagggu −0.955 No
miR-918 bta-miR-2285b aaaaucugaacaaacuuucugg −0.849 No
oar-miR-136-5p mmu-miR-136-5p acuccauuuguuuugaugaug −0.830 No
oar-miR-218a hsa-miR-218-5p uugugcuugaucuaaccaug −0.786 No
oar-miR-411b-5p mmu-miR-412-5p uggucgaccauaaaacguacgu −0.763 No
miR-325 uacugugccacggauggguagc −0.742 No
miR-355 uacugugccacggauggguagc −0.742 No
miR-78 mmu-miR-542-3p ugugacagauugauaacugaaa −0.690 No
miR-643 mmu-miR-873a-5p gcaggaacuugugagucuccu −0.684 No
miR-88 ssc-miR-7134-5p auguccgcggguucccuauccc −0.680 No
miR-81 hsa-miR-424-3p caaaacgugaggcgcugcuaua −0.674 No
miR-30 mmu-miR-146a-5p ugagaacugaauuccauaggcugu −0.657 No
miR-52 hsa-miR-4456 ucuggugggaaggaagggac −0.655 No
oar-miR-10a cel-miR-57-5p uacccuguagauccgaauuugu −0.650 No
miR-166 mmu-miR-184-3p uggacggagaacugauaagg −0.648 No
miR-205 hsa-miR-3199 agggacugaggcgugagccu −0.623 No
miR-245 cccgguacugagcugacccgagc −0.612 No